Busch Lab

ZMP

ENSDARG00000051970

Ensembl ID:
ENSDARG00000051970
Human Orthologue:
SMU1
Human Description:
smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) [Source:HGNC Symbol;Acc:18247]
Mouse Orthologue:
Smu1
Mouse Description:
smu-1 suppressor of mec-8 and unc-52 homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1915546]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa18504 Nonsense Available for shipment Available now
sa32737 Nonsense Mutation detected in F1 DNA Not yet available
sa15438 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18504
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073694 Nonsense 167 539 4 13
Genomic Location (Zv9):
Chromosome 1 (position 45494371)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44337590
GRCz11 1 45038893
KASP Assay ID:
2259-0946.1 (used for ordering genotyping assays)
KASP Sequence:
CTGGAGAGGTCTGTTTGGTGCCCCCTTCTCGTCTCATGGGTCTTCTTGGY[C/T]AGGTTTGACACCTTTCATTTCTTTTCTTTTTTTNTCTAACCTGTTGCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32737
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073694 Nonsense 383 539 10 13
Genomic Location (Zv9):
Chromosome 1 (position 45477580)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44320799
GRCz11 1 45022102
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTGAAGGAGTTTAGAGGCCACACAGCTCATGTAAACGATGTCATCTA[C/A]TCGCACGACGGCCAGCATGTCATTAGCGCATCGGCGGACGGCACGGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15438
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073694 Essential Splice Site 400 539 10 13
Genomic Location (Zv9):
Chromosome 1 (position 45477528)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44320747
GRCz11 1 45022050
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCACGACGGCCAGCATGTCATTAGCGCWTCGGCGGACGGCACGGTAAAA[G/A]TATGTWTTCACACTGTAGTGTCCWGCCTTTACTAGTCTTTGCCTTTCASA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25644
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073694 Essential Splice Site 456 539 11 13
Genomic Location (Zv9):
Chromosome 1 (position 45477266)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44320485
GRCz11 1 45021788
KASP Assay ID:
2259-0944.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTGAGCAATAGGACCAACACAGTGGTTGTTACGAACATTCATGGCCAG[G/A]TGAGAAACACTAATTGACCAAAACTGGCTTAAAGGAGTCTTTTTCGGGCC
Associated Phenotype:
Not determined