Busch Lab

ZMP

MMP15 (2 of 2)

Ensembl ID:
ENSDARG00000051962
Description:
matrix metallopeptidase 15 (membrane-inserted) [Source:HGNC Symbol;Acc:7161]
Human Orthologue:
MMP15
Human Description:
matrix metallopeptidase 15 (membrane-inserted) [Source:HGNC Symbol;Acc:7161]
Mouse Orthologue:
Mmp15
Mouse Description:
matrix metallopeptidase 15 Gene [Source:MGI Symbol;Acc:MGI:109320]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa13887 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30233
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073684 Essential Splice Site 283 651 6 10
Genomic Location (Zv9):
Chromosome 25 (position 17927611)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17471475
GRCz11 25 17567875
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGCATGATTAGCTAAGTGTGAAAATGCATTATGGTTTGGTATGTGCA[G/T]GATCTCCAGAGACTGTCACCACTCAAGCAGCTCCCACCACCACCCTGTTT
Long Flanking Sequence:
GTATTATGAAAGACCACCATAAATAATAACATAAAACCAGATGTGATTCAAACATCCTATTGTTGATAGACCTTTGAAATGGCACGTTATTGTTCAGTGAAAGTGTCTCGATTTGATTTAATTGCTTAAGATTGATGCTTTATGCAAAAACCCAAAAGACTCTTTTGCAATCTGATGCAACTATGCATATCAGTCATTATCCGGCTGTTTCTTTAAGTGTTGTCACATTTACGATACATTTGTTATCCTCACTGTGCAGTTGTGTAACTTCCCAGTCTCCAGACCAGCTGCATTGAGATCAGCACCACTGAATTTCTCACTGTGTCTCTTTGTCTGAGTCTGTTTTCTCCATTTGAAAGCCGTCCATTGCTGGCTGAATGAGCCTCATGGGCCTTCTGGTGCTGGATGGAAAAGAGTGACACGTTCTGTGTCTGTGCAGTGTGTGTGGAACAGAGCATGATTAGCTAAGTGTGAAAATGCATTATGGTTTGGTATGTGCA[G/T]GATCTCCAGAGACTGTCACCACTCAAGCAGCTCCCACCACCACCCTGTTTACAACCACTGCCAAGCCAGAGCCCACCACCACAGAGGCTCAGCCGAAAACAACCAGACCTTCACTGCAGCCCACCAGGCCTTGGGTGCCTCCTGTCAATCCCACCAGGAGGACCTATAGACCCCAGCCCACCAGCCGCTCCAATCAGGATGCACCTGACATCTGCGAGGGCAACTTCGACACGGTGACCATGCTGAGAGGAGAAATGTTTGTATTCAAGGTTAGAAAGAAGCATCATATATATATATTATCATTATATATGTTATCATTAAGCCTTTCCCCTCCTATGTAGATGACAGGGTTTCTGTGTGGTCTTAAATTTTTAATGTCTTTAATCTTAAAATCTAAATTTTAGGCCTTAAGTTTTACATTTATTGAAATGTTTTGTTGTAGGTTTTAAATCATTTTAAACAGGTCTTATTTTTCCTTTATGTATTGCTACCCAATCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13887
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073684 Essential Splice Site 468 651 8 10
Genomic Location (Zv9):
Chromosome 25 (position 17922222)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 17466086
GRCz11 25 17562486
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGTGTGGTGGGAGCCATCTGGATATAYGTACTTCTTCAGAGGAGACRGG[T/C]AAACAATWCTGGGGCCCTCGCTGAAAAGACCAGATGTGTGAAGTGCTTGA
Long Flanking Sequence:
CATACATGATATTATTAGACTTTTTTAGTTAGTGCTGAACAAATTTATTGGATGTAAATCTTGCCCTTGATTAAATTAAGTTCATGCAATGAGTAATTTTTTAAATGCAGTTAGAAAACATAAAAACTGTTTTAACTATGTCAGTTCAAGCGGTCTATTTAAAAACACAAAAAAATCTCACTCAAACTTTTGACTAGTAGTGTAGATTACATTCATTTCTGCTTTCGTGCTGCACAAAACATCTTTTGTGTATGTGAATAATGGAACAGAGAGCGCAATGATATCATCTCTCAGCCATGCAAGTCTTTCCCCACTAATATAGTTTTCTTTGTGTAACTATCACTCCTTCAGGAAGTAAATACTGGCTCTTTAGAGAAGCAGACGTGGAGCCCGGGTACCCTCAGGACTTGTTTCGTTATGGTCAAGGCATGCCTGAAAGAGTGGACACGGCCGTGTGGTGGGAGCCATCTGGATATACGTACTTCTTCAGAGGAGACAGG[T/C]AAACAATACTGGGGCCCTCGCTGAAAAGACCAGATGTGTGAAGTGCTTGAGAATTTGCCATCAGAACAACATAAACAACGAGGGTTACTTGGATCTGGGAATTAAAATTGAAGAAAATTTGTGTCAGTAGGTCATTTGTCTATGAGACACAAATGAAGTGATTGTTTTAATGAGTGAATTATTGAACTATTCATCTAACGAGTTCATTAAAATAACACTTGACTCTTTTGGGAACGAAACAAGTGACTGACTTAATGAGGGAATCATTGAATTATTCACTTAACCAATTTCATTTAAAGACCACTTGATTCATTTAGGACTATAAAAAGGCTACGTTCACACTGCAGGCTAATGTAGCCAAAATCTTTTTTTTTTTGCCCACATGTGACTGTTTTTTTTTCTTGACAGTGTGAACGGTCCAAACCGCATGGAATCTGATCTTTTCAGTTCAGATTTGTGCCACTTCATATGTAGTATTAAATCAGACACAGATCTGATAT
Associated Phenotype:
Not determined