Busch Lab

ZMP

plag1

Ensembl ID:
ENSDARG00000051926
ZFIN ID:
ZDB-GENE-060302-2
Description:
pleiomorphic adenoma gene 1 [Source:RefSeq peptide;Acc:NP_001034903]
Human Orthologue:
PLAG1
Human Description:
pleiomorphic adenoma gene 1 [Source:HGNC Symbol;Acc:9045]
Mouse Orthologue:
Plag1
Mouse Description:
pleiomorphic adenoma gene 1 Gene [Source:MGI Symbol;Acc:MGI:1891916]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa9509 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9509
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073640 Nonsense 283 393 3 3
ENSDART00000127884 Nonsense 283 393 2 2
Genomic Location (Zv9):
Chromosome 7 (position 59984802)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 58437411
GRCz11 7 58739851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAWGCCTCCTACTCACCACCGCCACCCTTGAGAGCAGAGCTTGAAAGTTA[T/G]CTTCTAGAGCTACAGGCTGAAGATACACCCAAGCTGAGTTCTTCCACCAC
Associated Phenotype:
Not determined