Busch Lab

ZMP

ANKRD11

Ensembl ID:
ENSDARG00000051886
Description:
ankyrin repeat domain 11 [Source:HGNC Symbol;Acc:21316]
Human Orthologue:
ANKRD11
Human Description:
ankyrin repeat domain 11 [Source:HGNC Symbol;Acc:21316]
Mouse Orthologue:
Ankrd11
Mouse Description:
ankyrin repeat domain 11 Gene [Source:MGI Symbol;Acc:MGI:1924337]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa16144 Essential Splice Site Available for shipment Available now
sa17722 Nonsense Available for shipment Available now
sa31604 Nonsense Available for shipment Available now
sa31605 Nonsense Available for shipment Available now
sa41040 Nonsense Mutation detected in F1 DNA Not yet available
sa31606 Nonsense Available for shipment Available now
sa7090 Nonsense Mutation detected in F1 DNA Not yet available
sa11367 Nonsense Available for shipment Available now
sa21093 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16144
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Essential Splice Site 248 2820 5 11
Genomic Location (Zv9):
Chromosome 7 (position 57657759)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56093085
GRCz11 7 56394496
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGATGACGACACGCCTCTACATGATGCATCTAACAATGGCCATCTCAAAG[T/C]AAGTGACTCAGAAATKATACWTTACAKTTTTTTACACAAGATAGCAMACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17722
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 289 2820 6 11
Genomic Location (Zv9):
Chromosome 7 (position 57657986)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56093312
GRCz11 7 56394723
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGCAAATTCACAAACAATGCTTAATTTGTTGTTGGGGAAAATCACCTA[C/A]TCCTCCAGTGAGGAGAGTTCCTCWGGTATGTATCATGAAGTGCATCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31604
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 599 2820 7 11
Genomic Location (Zv9):
Chromosome 7 (position 57659002)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56094328
GRCz11 7 56395739
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGTGAGTCAGACTACTCATCTGCAGACTCCAGTGTTGAGTCTGTGAAA[C/T]AGGTAAAAAAGAAAGTGCAAGACAGCAGAAAGAAAAACAACACGCATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31605
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 1548 2820 7 11
Genomic Location (Zv9):
Chromosome 7 (position 57661851)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56097177
GRCz11 7 56398588
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGGAAAACACTCAAATATCAAGTATTAAAGAGAAATCAAAAGAAGACTG[T/A]TCTAAATTTGACGGCAAAAATAAGGACAGGATTAAAGATATAGTGGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41040
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 1768 2820 7 11
Genomic Location (Zv9):
Chromosome 7 (position 57662509)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56097835
GRCz11 7 56399246
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGCCATCCTGCAGTGCAGAGGACTATTCAGATATCATGTTTGATGGTCTT[G/T]AGTGTCATAATTCCTCAGCCACCACAATGTCCATGAATGCTTGTTCCCCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8287
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 1911 2820 7 11
Genomic Location (Zv9):
Chromosome 7 (position 57662940)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56098266
GRCz11 7 56399677
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTGCTGTAAATTCCATCAGTGATGGWAATGAATACTCAGGGTGTGTGTA[T/G]AACARCTATCTMATGAAGCCCTCAACTCCAGTCCATAGACYTGACCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31606
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 2170 2820 7 11
Genomic Location (Zv9):
Chromosome 7 (position 57663715)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56099041
GRCz11 7 56400452
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACACTGGAGTCCGAATCACCTCAGCTAGAAAATTTCTTCACTGATTGT[A/T]AACCAACCCCTGAGGAAAATCAGATGGACCTAGAGTTGCCATGCATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7090
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 2570 2820 7 11
Genomic Location (Zv9):
Chromosome 7 (position 57664915)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56100241
GRCz11 7 56401652
KASP Assay ID:
554-4997.1 (used for ordering genotyping assays)
KASP Sequence:
AGGTTCAGTTGGTGAACACAGCAATGAAGCAGACTCGGGAGATGATCCAA[C/T]AAACTCTAGCAGTCATTGTGAAYGCCATCAAATTGGATGAAATCGAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11367
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Nonsense 2664 2820 8 11
Genomic Location (Zv9):
Chromosome 7 (position 57665372)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56100698
GRCz11 7 56402109
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATTGCTCCACCACCATCTTTGTCAGARCCCCTGAAGGAGTTGTTCAGA[C/T]AGCAAGAGGCCGTGAGAGGAAAACTAAGACTACAACACAGCATTGAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21093
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073594 Essential Splice Site 2680 2820 8 11
Genomic Location (Zv9):
Chromosome 7 (position 57665424)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 56100750
GRCz11 7 56402161
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAAGAGGCCGTGAGAGGAAAACTAAGACTACAACACAGCATTGAGAGGG[T/A]AAACTTTTACTCTTTGCCTTTAGACTTTTTTTGTTTTCTCCCCTCTATGC
Associated Phenotype:
Not determined