Busch Lab

ZMP

abcc8

Ensembl ID:
ENSDARG00000051879
ZFIN IDs:
ZDB-GENE-050517-22, ZDB-GENE-050517-22
Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:RefSeq peptide;Acc:NP_001166118]
Human Orthologue:
ABCC8
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 [Source:HGNC Symbol;Acc:59]
Mouse Orthologue:
Abcc8
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 8 Gene [Source:MGI Symbol;Acc:MGI:1352629]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa15863 Nonsense Available for shipment Available now
sa44308 Nonsense Mutation detected in F1 DNA Not yet available
sa38076 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13411 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15863
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073586 None None 482 9 34
ENSDART00000088422 Nonsense 499 1594 10 40
Genomic Location (Zv9):
Chromosome 25 (position 23485467)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22664580
GRCz11 25 22762128
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTGGCTCCRGTGCAGTACTTTGTGGCAACCAAGTTATCAGATGCACAG[A/T]AAAGCACATTGGTGAGCTACTTTATTTTGGTTAATGTCCTAATGAGGCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30259
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073586 Essential Splice Site None 482 None 34
ENSDART00000088422 Essential Splice Site 809 1594 None 40
Genomic Location (Zv9):
Chromosome 25 (position 23530643)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22709756
GRCz11 25 22807304
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTACATTTCTATCCAACTGTGCTTCAGTCACGTATCTGTTGTTGTTTCC[A/T]GGTACAGAGCAGTAATTGAAGCATGTTCTCTCCAGCCGGACATTGACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44308
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073586 None None 482 21 34
ENSDART00000088422 Nonsense 856 1594 22 40
Genomic Location (Zv9):
Chromosome 25 (position 23531209)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22710322
GRCz11 25 22807870
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCTTTCTGGAGGCCAGAGACAACGGATTAGTGTGGCTCGAGCTCTTTA[T/A]CAAACTACCAATGTGGTGTTCCTGGTAGGTTAAGATACATCTGTACTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38076
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073586 Essential Splice Site None 482 23 34
ENSDART00000088422 Essential Splice Site 952 1594 24 40
Genomic Location (Zv9):
Chromosome 25 (position 23536984)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22716097
GRCz11 25 22813645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGAGCAGTGGAAGACTCTGATGCACAGACAAGACAAGGAATTTGAGAAG[G/A]TAGACTGCTGAAAATAAATGAGATATGAGAGAAAGCGTTTTGAAGGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13411
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073586 Nonsense 132 482 26 34
ENSDART00000088422 None None 1594 None 40
Genomic Location (Zv9):
Chromosome 25 (position 23550261)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22729374
GRCz11 25 22826922
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTYTATTTGGATCCTCTGCACTTTGTCGCTTCTGCACTTGATCTGCAATA[T/A]AAGATTATTACTTGTCTTGGATGCGGAAATAAAGCAGCGTGCACGCAAAA
Associated Phenotype:
Not determined