Busch Lab

ZMP

si:busm1-70b1.2

Ensembl ID:
ENSDARG00000051827
ZFIN ID:
ZDB-GENE-040724-9
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q6ZM43]
Human Orthologue:
GRAMD2
Human Description:
GRAM domain containing 2 [Source:HGNC Symbol;Acc:27287]
Mouse Orthologue:
Gramd2
Mouse Description:
GRAM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:3528937]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34194 Nonsense Mutation detected in F1 DNA Not yet available
sa21088 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27062
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073518 Nonsense 80 354 3 12
Genomic Location (Zv9):
Chromosome 7 (position 55739069)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53315441
GRCz11 7 53585093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTATTTCTCCTTTTCTCATAGGATACATCTAATAGATGATCTGTCATA[T/A]GAGGACGTCAAGAAATGCTATCGTGGATCTGTAAGTGACACACAGATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34194
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073518 Nonsense 95 354 4 12
Genomic Location (Zv9):
Chromosome 7 (position 55735398)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53319112
GRCz11 7 53588764
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGCAGCTGATTTCCCTTTCCTCTACCCCCTCACAGACCGTCAGCAAGTA[C/A]AATGCGCAGTACCACAAGCTCTTCCAGAGCGTGCCCAAAGAAGAGCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21088
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073518 Essential Splice Site 115 354 5 12
Genomic Location (Zv9):
Chromosome 7 (position 55728831)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 53325679
GRCz11 7 53595331
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTATCATCTTGCATCTCTTGCATAAGTGACCTTGTGACCTGTTCTTTA[G/A]TGTACTCATGCGCCCTGCTCAGAGATATCCTCCTGCAAGGCCGACTCTAC
Associated Phenotype:
Not determined