Busch Lab

ZMP

D2U819_DANRE

Ensembl ID:
ENSDARG00000051814
Description:
Protein tyrosine phosphatase zeta A [Source:UniProtKB/TrEMBL;Acc:D2U819]
Human Orthologue:
PTPRZ1
Human Description:
protein tyrosine phosphatase, receptor-type, Z polypeptide 1 [Source:HGNC Symbol;Acc:9685]
Mouse Orthologue:
Ptprz1
Mouse Description:
protein tyrosine phosphatase, receptor type Z, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:97816]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa24698 Nonsense Available for shipment Available now
sa44326 Nonsense Mutation detected in F1 DNA Not yet available
sa31112 Nonsense Mutation detected in F1 DNA Not yet available
sa17534 Nonsense Available for shipment Available now
sa5709 Nonsense F2 line generated Not yet available
sa3303 Nonsense F2 line generated Not yet available
sa14712 Nonsense Available for shipment Available now
sa18334 Nonsense Available for shipment Available now
sa44325 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa11576 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24698
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 223 2077 5 41
ENSDART00000127540 None None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29281651)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27971745
GRCz11 25 28414947
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGACTGTAGAGTGGATCGTCTTCAAAAACACAGTGGCCATCTCAGATGTT[C/T]AGGTCAGCTTTATTGACAGTTGTTGTTTCCCCCTGTTAGCTCATCAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44326
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 391 2077 10 41
ENSDART00000127540 None None 104 None 5
ENSDART00000073500 Nonsense 391 2077 10 41
ENSDART00000127540 None None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29254469)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27944563
GRCz11 25 28387765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATACAGTTTGATGACACATGGTACTTGAGGTTACATACAGTAGTTATAAA[C/T]AAAGCTCACACGCTTGCGTATAGTGTGTTCAGGCTGAAATCCAGTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31112
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 391 2077 10 41
ENSDART00000127540 None None 104 None 5
ENSDART00000073500 Nonsense 391 2077 10 41
ENSDART00000127540 None None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29254469)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27944563
GRCz11 25 28387765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATACAGTTTGATGACACATGGTACTTGAGGTTACATACAGTAGTTATAAA[C/T]AAAGCTCACACGCTTGCGTATAGTGTGTTCAGGCTGAAATCCAGTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17534
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 437 2077 12 41
ENSDART00000127540 None None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29253804)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27943898
GRCz11 25 28387100
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGATAAAATCATACATYTTCTACCTTTTAATRTTTCCATGCTTCACAAAT[C/T]GATATTGTCAACATATCACAAARTCTCTGGGGTCTTTTCCANCCATTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5709
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 930 2077 16 41
ENSDART00000127540 None None 104 None 5
ENSDART00000073500 Nonsense 930 2077 16 41
ENSDART00000127540 None None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29250721)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27940815
GRCz11 25 28384017
KASP Assay ID:
554-2906.1 (used for ordering genotyping assays)
KASP Sequence:
GTGGGTYGATTCTTCTCTAGCAGCTCCTACTTTCAGTAGTAAATTCTCYT[T/A]GCATGCCTCTTCCAACTCCCTGCTGCCTTCCTCGGTTTCTGRACTGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3303
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 930 2077 16 41
ENSDART00000127540 None None 104 None 5
ENSDART00000073500 Nonsense 930 2077 16 41
ENSDART00000127540 None None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29250721)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27940815
GRCz11 25 28384017
KASP Assay ID:
554-2906.1 (used for ordering genotyping assays)
KASP Sequence:
GTGGGTYGATTCTTCTCTAGCAGCTCCTACTTTCAGTAGTAAATTCTCTT[T/A]GCATGCCTCTTCCAACTCCCTGCTGCCTTCCTCGGTTTCTGRACTGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14712
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 1100 2077 16 41
ENSDART00000127540 None None 104 None 5
ENSDART00000073500 Nonsense 1100 2077 16 41
ENSDART00000127540 None None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29250211)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27940305
GRCz11 25 28383507
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTGCAGATGGGCAGCAGGAGAACAGTGCCTCAGGCTGGACTTTCGATT[T/A]AGACTGGGGCCAAAGCTCAGCATCAGGAGACGAGAGTATYGCCGCTSCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18334
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 1100 2077 16 41
ENSDART00000127540 None None 104 None 5
ENSDART00000073500 Nonsense 1100 2077 16 41
ENSDART00000127540 None None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29250211)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27940305
GRCz11 25 28383507
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTGCAGATGGGCAGCAGGAGAACAGTGCCTCAGGCTGGACTTTCGATT[T/A]AGACTGGGGCCAAAGCTCAGCATCAGGAGACGAGAGTATYGCCGCTSCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44325
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Essential Splice Site 1276 2077 20 41
ENSDART00000127540 None None 104 None 5
Genomic Location (Zv9):
Chromosome 25 (position 29249093)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27939187
GRCz11 25 28382389
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGTCCTAGGCCATGTCTTAATCTCTCAAACGTGTCTGTCTGCAATGAA[T/A]CATGACCTATGAACTTCTTAGCTTCTTTGTGTGAAACACATTTCTGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11576
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073500 Nonsense 1823 2077 36 41
ENSDART00000127540 None 5 104 1 5
Genomic Location (Zv9):
Chromosome 25 (position 29224317)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27914411
GRCz11 25 28357613
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGTTAGTTCCACAAAAGTGACTGYGGTGTGTTTTGCAGTGGAGAAGTCT[C/T]GAGTGTGTGYGTCCTCGTCAGCAGGAGAAACRTCAGATTACRTCAACGCC
Associated Phenotype:
Not determined