Busch Lab

ZMP

LOC562203

Ensembl ID:
ENSDARG00000051795
Human Orthologues:
AC019294.4, MX1, MX2
Human Descriptions:
Putative UPF0621 protein C [Source:UniProtKB/Swiss-Prot;Acc:A8MV40]
myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) [Source:HGNC Symb
myxovirus (influenza virus) resistance 2 (mouse) [Source:HGNC Symbol;Acc:7533]
Mouse Orthologues:
Mx1, Mx2
Mouse Descriptions:
myxovirus (influenza virus) resistance 1 Gene [Source:MGI Symbol;Acc:MGI:97243]
myxovirus (influenza virus) resistance 2 Gene [Source:MGI Symbol;Acc:MGI:97244]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44285 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa38060 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa24662 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44285
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104347 Splice Site, Nonsense 164 626 3 12
Genomic Location (Zv9):
Chromosome 25 (position 20174278)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19586255
GRCz11 25 19684206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGTATAACCAGAGTACCAGTCAAAGGCCAACCAGAAGACATCGGAGAC[C/T]AGGTGAACATCAGAAAAATTGCTTTATTAAAAAGCAAATGTCTATGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38060
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104347 Splice Site, Nonsense 467 626 10 12
Genomic Location (Zv9):
Chromosome 25 (position 20179624)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19591601
GRCz11 25 19689552
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATGTGCGAGCTATGTTTCCCAAACTACCCGCATCTGAGACACATAATA[C/T]AGGTAGGTTCAAATGACTCTTGTTTATCATTTTGTATCATTTTATAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24662
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104347 Nonsense 556 626 12 12
Genomic Location (Zv9):
Chromosome 25 (position 20183757)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19595734
GRCz11 25 19693685
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTAATTGCACTGAAAATCTCATGTCCTCTCGGTCAATCAGATTGTGTA[T/G]CAGCGTCTGGCCGACTACATTCCCATGGTGATCCTGTTGTTCATGCTGAA
Associated Phenotype:
Not determined