Busch Lab

ZMP

tigara

Ensembl ID:
ENSDARG00000051749
ZFIN ID:
ZDB-GENE-060312-25
Description:
Probable fructose-2,6-bisphosphatase TIGAR A [Source:UniProtKB/Swiss-Prot;Acc:Q29RA5]
Human Orthologue:
C12orf5
Human Description:
chromosome 12 open reading frame 5 [Source:HGNC Symbol;Acc:1185]
Mouse Orthologue:
9630033F20Rik
Mouse Description:
RIKEN cDNA 9630033F20 gene Gene [Source:MGI Symbol;Acc:MGI:2442752]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa38041 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38040 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24639 Essential Splice Site Available for shipment Available now
sa44263 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa38041
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111158 Essential Splice Site 11 256 1 6
Genomic Location (Zv9):
Chromosome 25 (position 17326786)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16873330
GRCz11 25 16969730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACGACGCGTCTGCGACATGCTCGCCTTTGGTTTAACAGTAGTCCGACAG[T/C]AAGTTCTGTTTTGTTTGCTTTATGAAAGTGATTTGTTCTATTCATAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38040
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111158 Essential Splice Site 24 256 2 6
Genomic Location (Zv9):
Chromosome 25 (position 17325082)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16871626
GRCz11 25 16968026
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTTTGCCAGTGGTGAGACGCAGTGCAACAAAGATGGCCTTTTACAAGG[T/G]AATTGTTTAGAGAGAAAATTAAAACATATGTTATCTCTACGCATTGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24639
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111158 Essential Splice Site 64 256 3 6
Genomic Location (Zv9):
Chromosome 25 (position 17324850)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16871394
GRCz11 25 16967794
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGAAATTTACAAATGTGTTTGTCAGCAACATGAAACGTGCCAAGCAGG[T/C]AAACAGAAACACACCAGTAACTAAAACATTCAATCTGTTTACCAGTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44263
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111158 Nonsense 142 256 6 6
Genomic Location (Zv9):
Chromosome 25 (position 17321564)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16868108
GRCz11 25 16964508
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTCCAGGTGAAGTTGCGAATTAAGGATTTTCTGAAGGCCATGTACCAG[C/T]GAATAGCAAATGACCATCAAGACAAAGTACAAGATGGAGGAACATCCTCA
Associated Phenotype:
Not determined