Busch Lab

ZMP

cecr1a

Ensembl ID:
ENSDARG00000051746
ZFIN ID:
ZDB-GENE-030902-4
Description:
Adenosine deaminase CECR1-A [Source:UniProtKB/Swiss-Prot;Acc:P58781]
Human Orthologue:
CECR1
Human Description:
cat eye syndrome chromosome region, candidate 1 [Source:HGNC Symbol;Acc:1839]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38038 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44262 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30225
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073416 Essential Splice Site 174 503 3 10
Genomic Location (Zv9):
Chromosome 25 (position 17051626)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16598170
GRCz11 25 16694570
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAGATCCCTCAGGGAAAAAATTAAAAACACCACTGAACTGGACAACAGG[T/C]AAAACAAAACTTATTCTGAGACTGTAACTGAGTAAGGTTTTGTTTTATAT
Long Flanking Sequence:
GTAAATGGGAAAGCAAAGAAACTGAATTAACTTTTTTAAAGGCAACTCAGATATTTTCTCAGAAATAAAGAAGTAATTTGTGACTTTACTAGCTACTTGAAAAAAGAAATCTGATTACGAAACTCATATTACGTGTATTAACTAACAGTGGATGTCATTACTATCATTCTACTGCAAAGCTAAATTACCTAAAAGCTAAACTAACCTTACCATATATTTCATAACAGTGTAACTCCCCATAGGCTTAACTATGTTGATTGATATGATTTATATTTTCAGGTGCTGCACTGCACGTACACGACTTTGCTATGGTTTCAGTGGATTGGCTGGTGAAGAACGTGACCTACAGAGAGAACTGCTATGTTTGCTTCACAGACAAGCAGACCGTGCAGTTCATCTTTTCCACTGGACCACCAGCATCCAGTTTACACTGCTCCTCATGGACTCTGCTCAGATCCCTCAGGGAAAAAATTAAAAACACCACTGAACTGGACAACAGG[T/C]AAAACAAAACTTATTCTGAGACTGTAACTGAGTAAGGTTTTGTTTTATATGTCTCAATTTCCTTTACAGTTTTATTCGAAATCTCACGCTCTTTACTGAAGACCCAGATAGAGCTTATCCTAATCAGGATACTGTGTGGGAGAGGTTCGAGCAGGTATTTTTAGTGGCCTATGGGTTGGTCACTTATGCCCCTGTCTTTAAAGACTACCTCTATGAAGGTCTCCGACAGTTTTATGAGGACAACATCATGTATGTGGAGATCAGAGCACTGCTGCCACAGGTATGGATAAGTCTGACCTGATTTAAAAAAAAATCCTAAATTAGATCTAAAATTTAATAAAAAATTTTTAAAAGATATTTGTGATTTTTTTATCTCACAATTTTGAGCTTATATACAATTTATGAATTGAGAAATCTTACTATTCTCACTTTTGTTTGCAGTTTATATAGCACAATTGTAAATTATAACCTTATATTTGTCAGTTAACATTTAGCATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38038
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073416 Essential Splice Site 474 503 9 10
Genomic Location (Zv9):
Chromosome 25 (position 17056941)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16603485
GRCz11 25 16699885
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGCTTTAATTTAGGCACATTGAAAGAGCTAGCTTTAAACTCCCTCAG[G/A]TAGGAAATGACCACAATTTAAACAAAAAAGAGACTGTATATGCAAGCTTG
Long Flanking Sequence:
CTTCTTGCTGTGAGGCTAACCACCGTGTCACCCTGCAAATTTATAACACAAAATTATTAGCCCTTCTCTGAAATTTAAATACTTTTTCAAATATTTCATAAGTGATGTTTAACACAGCAAGGAAAGATTGCGCGATTCGATATAATATTGTTTATTAGCACTACTTTAGCTAAAAACTAACATTGAATTGAACTATACTAAATCATATTTCATTTTCGTTTATAAGAAATAAAACATAATGTATTCAATACAATATTAAATAGCATTTTACCTGAAAATTGTTTTCTTCTCTTTCAGGTGTTGAAGCTGGTCTCAGACCTGCGGGATCATCCGGCTGCAGTGCTGATGGCTGAAGGTCATCCTCTGGTGATCAGCTCTGATGATCCTGCTGTTTTTGGAGCCACGGCTCTTTCACACGATTTTTATGAAGCTTTTATGGGTTTTGGAGGAATGAGCTTTAATTTAGGCACATTGAAAGAGCTAGCTTTAAACTCCCTCAG[G/A]TAGGAAATGACCACAATTTAAACAAAAAAGAGACTGTATATGCAAGCTTGTACATTTAGGTGTCCTCAATATTTAATGTGTGCTCTGGTTCTTCATTTATAGGTACAGCACATTGCCAAGTCAAAGAAAGGAGGAAGCTATCGACGCTCTGCTAGTAAAATGGGACAAGTTTGTTTGGGAAAGTTTACTTTGACAGGACGTTACCACATCAGGACGTTTTTAATTAGGAGGCCATTGTTTACAAGACATCTACGTCATTTGTTTGTCGTATTGGTGATACTGAGGTGCGAAAACGCCAATTTATGCTGAGAGAAACAGAATGTAATGCCTTGAACTGATCTGTGCTGCCATCTTGTGGAGAATCTGAAGCAGTGCTTTTGTGAATATTAATCGTGGTTTCAGATTTATATAAATGTAAAGTCACACAATCTGAACGGGGTTAACTACTTAACTACTCAGGATGCGTGATAAACCTTGTCTTGTTGTAAGTGTGCATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44262
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073416 Nonsense 500 503 10 10
Genomic Location (Zv9):
Chromosome 25 (position 17057120)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16603664
GRCz11 25 16700064
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGAGGAAGCTATCGACGCTCTGCTAGTAAAATGGGACAAGTTTGTTTGG[G/T]AAAGTTTACTTTGACAGGACGTTACCACATCAGGACGTTTTTAATTAGGA
Long Flanking Sequence:
ACATTGAATTGAACTATACTAAATCATATTTCATTTTCGTTTATAAGAAATAAAACATAATGTATTCAATACAATATTAAATAGCATTTTACCTGAAAATTGTTTTCTTCTCTTTCAGGTGTTGAAGCTGGTCTCAGACCTGCGGGATCATCCGGCTGCAGTGCTGATGGCTGAAGGTCATCCTCTGGTGATCAGCTCTGATGATCCTGCTGTTTTTGGAGCCACGGCTCTTTCACACGATTTTTATGAAGCTTTTATGGGTTTTGGAGGAATGAGCTTTAATTTAGGCACATTGAAAGAGCTAGCTTTAAACTCCCTCAGGTAGGAAATGACCACAATTTAAACAAAAAAGAGACTGTATATGCAAGCTTGTACATTTAGGTGTCCTCAATATTTAATGTGTGCTCTGGTTCTTCATTTATAGGTACAGCACATTGCCAAGTCAAAGAAAGGAGGAAGCTATCGACGCTCTGCTAGTAAAATGGGACAAGTTTGTTTGG[G/T]AAAGTTTACTTTGACAGGACGTTACCACATCAGGACGTTTTTAATTAGGAGGCCATTGTTTACAAGACATCTACGTCATTTGTTTGTCGTATTGGTGATACTGAGGTGCGAAAACGCCAATTTATGCTGAGAGAAACAGAATGTAATGCCTTGAACTGATCTGTGCTGCCATCTTGTGGAGAATCTGAAGCAGTGCTTTTGTGAATATTAATCGTGGTTTCAGATTTATATAAATGTAAAGTCACACAATCTGAACGGGGTTAACTACTTAACTACTCAGGATGCGTGATAAACCTTGTCTTGTTGTAAGTGTGCATTAAAGGGAATGTTCACGCAACAATGGTAAATTCAGTCATCAACTTGCTTGAGTTTCTTCCGTTGAACACAAAGAAGTTTTTAGGCATTCTGCAAAGTACCATTTTTGTTTTCAACAGAAGAAAGGAACTCCTGAAGGTCTGTAACTATTTAAAGAGGAAATAGTGAGTATTTTTGGTGTGAAC
Associated Phenotype:
Not determined