Busch Lab

ZMP

zgc:162267

Ensembl ID:
ENSDARG00000051731
ZFIN ID:
ZDB-GENE-070410-53
Description:
Fanconi anemia-associated protein of 24 kDa [Source:RefSeq peptide;Acc:NP_001082992]
Human Orthologue:
C19orf40
Human Description:
chromosome 19 open reading frame 40 [Source:HGNC Symbol;Acc:28467]
Mouse Orthologue:
C230052I12Rik
Mouse Description:
RIKEN cDNA C230052I12 gene Gene [Source:MGI Symbol;Acc:MGI:2142208]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32546 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30313
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073399 Nonsense 44 215 2 4

The following transcripts of ENSDARG00000051731 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 37326459)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35740105
GRCz11 25 36289824
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGTCTCTGTATGTTGTCTTTGTTCTCAGGAAGTGTAAAGATGATCTTC[G/T]AGGAGGAGCTCGGTGTTGTCGACTTCTGTCTCAGTAACAAGACGTGTGTC
Long Flanking Sequence:
TATATGCAAGAATATAATATTTTTATTAATAATAGTATTATTATTTGATGCTGACATCCAAATGGTATTTGGACAATTTACTTTTAATTATTGTAGGTTTTACTGTTGTTGTTTTGATTAGAGTGACATATAAAGTGTTTTAATTTACATTTTCATTTGAATTTGTATTGCTTTTAACAGAATGTTGTTTAATATTTGTGGCTGATTTCATATTTTAATTTAACATTTAAGACTTTAATTCTGGTTAAAAAAGTTTTTAGTGTTACATAAAAATTGTACCATGGTAATTAATCATACATTTAACACTAGTTACACCTTAACACTAGTTCATTTTTATACTAGTTTTTATTTATCCCTTGCTTTTAGTTGTGTGTTTTAAATTTGAAAAATTAGTATAATGACAGTTAGTCTAGTGTTTGTGATGCATCTTGTCTTCTCAAAGAATTTATTGATGTCTCTGTATGTTGTCTTTGTTCTCAGGAAGTGTAAAGATGATCTTC[G/T]AGGAGGAGCTCGGTGTTGTCGACTTCTGTCTCAGTAACAAGACGTGTGTCCTCTATGTGTCAGAAAGTGACCTGGTGGCAGGAAACGGCTACAAGAGGAAGATCGTCCGCTTTAGAAATGTACACATAGACTCATTTGATATTTTAGAGCTTCACAATTAAATTATAATAAACAATTTAGTTATGTTGATGCATCCAGAGGTCCCCAGCTAAAAATTTAGATTTTTTTTTCAAGCTCTTTCAAAATAAATATAAGCATCACCACATGAATTGTACATACACTGACACATTTTGTTACTTTTTTGCATGAACTATACCTTTAAAAAAACAAATAATGTTAAAGTTAAAACTAGAAAATTGTATAATTAAAAGATTTTTAAAAAATCACACACACACCACACACACACACACACATAAATTGTCGATTACTTGGGTAATACTAATCTGTCCTTACTACTTTAACCTGCTTTTATTAAATGTGTTTTTTTTGTGTGTGTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32546
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073399 Nonsense 98 215 3 4

The following transcripts of ENSDARG00000051731 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 37325349)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35738995
GRCz11 25 36288714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTGCAGGCGAACAGTGGTCTGCAGGCTGTAGTGATCGTGGAGAAGACT[C/T]GAGTGAGCGAGCAGTATTTCAGCGCACTGCAGAAGTTTGTGGTTTTGGAG
Long Flanking Sequence:
TAGTCCCTTATTTATTAGGTGTTGCCATAGTGGAATGAACCACCAACTATTCCATCATATGTTTTACCCTGCAGATGCCCTTCCAGCTGCAACCCAGTACTGTGAAACACCCATACACACTCACATTTACACACACACTCGTACACTACGGCCAATTTAGATCATCTAATTCCTCTATAGCGCATGTGTTTAGACTGTGGGGGAAACCGGAGAACCCTGAGGAACCCACGCCAACACGGGGAGAACATGCAAACTCCACACAGAAACGCTTACTGGCCCAGCTGAGACTTGAATTAAACGACCTCCTTGTCACAGTGTTAACCACTGAGCCACCGTCATCAAAATGATCATTTTTCATTTAGATTTGCTCTCATCTTTCTCCGATTCCATAAACATGGGGCTGGAAAACAGTGTTGATGTTGATAAGCCAGAGTAAGTGCTTGTGCTGTTTCCTGCAGGCGAACAGTGGTCTGCAGGCTGTAGTGATCGTGGAGAAGACT[C/T]GAGTGAGCGAGCAGTATTTCAGCGCACTGCAGAAGTTTGTGGTTTTGGAGCTGGGTTTGACTCTTCTGCCGGTTTCCACCTCGGCTGAGGCTGCTCAGCTCATCGCTCAGCTGGTGAGTACATCACATGGTCAACCTGTCACTCACATGAGATCCACCAAAAGGAAACCACAATATTCATTTTCCTTCGGCCTAATCTCTATTTTAGAGGTCGCCACAGCGGAATGAACCGCCAACTATTCCGGTATATGTTTTTTATGTAGTGGATGCTGCATAACACACTCATTCACAGACACTCTCGTACACTAGAGACAATTTAGTTTATTCAAATCCCCTATAGCGCATGTGTTTGGACTGTGGGGGAAACCGGATCACCCGGAGGAAACCCACGCCAACACAGGGAGAACATGCAAACTCCACACAGAAATCCCAACAGATCCAGCCAGGACTCAAACCAGCGACCTTCTTGCTGTGAGGTCACAGTACTAACCACTGATTCAC
Associated Phenotype:
Not determined