Busch Lab

ZMP

si:ch73-46g7.3

Ensembl ID:
ENSDARG00000051729
ZFIN ID:
ZDB-GENE-100922-25
Human Orthologue:
NFATC3
Human Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 [Source:HGNC Symbol;Acc:77
Mouse Orthologue:
Nfatc3
Mouse Description:
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3 Gene [Source:MGI Symbol;Ac

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa974 Nonsense Available for shipment Available now
sa24732 Nonsense Available for shipment Available now
sa31116 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44358 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa974
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032386 Nonsense 242 923 2 10
ENSDART00000134928 Nonsense 231 912 1 9
Genomic Location (Zv9):
Chromosome 25 (position 37279135)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35692781
GRCz11 25 36242500
KASP Assay ID:
554-0879.1 (used for ordering genotyping assays)
KASP Sequence:
TATCATCAGCAATCTCTGCAGTATCCGTTTGCCCAGTCTCTATCTCCGTA[T/A]CAATCCCCCCGCACCAGYATCACTGAGGAAACATGGCTCAGTCCGCGTCC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa24732
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032386 Nonsense 339 923 2 10
ENSDART00000134928 Nonsense 328 912 1 9
Genomic Location (Zv9):
Chromosome 25 (position 37278846)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35692492
GRCz11 25 36242211
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACACCCTTCCAGTGGACGTGGATGTCCCATCCAAAACCAGAAGAACTTAT[C/T]AGGCAAACCACAACCAGGATCAAGCATCTTTGTTTTCTGGGCAAGAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31116
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032386 Essential Splice Site 648 923 7 10
ENSDART00000134928 Essential Splice Site 637 912 6 9
ENSDART00000032386 Essential Splice Site 648 923 7 10
ENSDART00000134928 Essential Splice Site 637 912 6 9
Genomic Location (Zv9):
Chromosome 25 (position 37267620)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35681266
GRCz11 25 36230985
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACAATGGGAGGTCAACGTGAGGCCTTTACCGGAGAAGAGTCAAAACG[T/C]GAGCACTGTAAACATTATGCTATGAAACGCTGCAATTCCTCATTTTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44358
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032386 Essential Splice Site 648 923 7 10
ENSDART00000134928 Essential Splice Site 637 912 6 9
ENSDART00000032386 Essential Splice Site 648 923 7 10
ENSDART00000134928 Essential Splice Site 637 912 6 9
Genomic Location (Zv9):
Chromosome 25 (position 37267620)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35681266
GRCz11 25 36230985
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACAATGGGAGGTCAACGTGAGGCCTTTACCGGAGAAGAGTCAAAACG[T/C]GAGCACTGTAAACATTATGCTATGAAACGCTGCAATTCCTCATTTTCTAG
Associated Phenotype:
Not determined