Busch Lab

ZMP

CASKIN1 (1 of 3)

Ensembl ID:
ENSDARG00000046107
Description:
CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
Human Orthologue:
CASKIN1
Human Description:
CASK interacting protein 1 [Source:HGNC Symbol;Acc:20879]
Mouse Orthologue:
Caskin1
Mouse Description:
CASK interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:2442952]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa9831 Essential Splice Site Available for shipment Available now
sa45143 Nonsense Mutation detected in F1 DNA Not yet available
sa33234 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20076 Nonsense Available for shipment Available now
sa14718 Nonsense Available for shipment Available now
sa20075 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26108
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031390 Essential Splice Site 33 1347 1 21
Genomic Location (Zv9):
Chromosome 3 (position 35770253)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35555449
GRCz11 3 35684957
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACTACTGCTGGACTCTCAGGCCCTAGTGGACATCAGGGACCAGAAAGG[T/C]ACCAGAAAAAAAATTAATGCAAAATGTTAGCTTTACATCGCCATCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9831
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031390 Essential Splice Site 81 1347 2 21
Genomic Location (Zv9):
Chromosome 3 (position 35768880)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35554076
GRCz11 3 35683584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGGTCAGATCCCCCTGCACCTGGCTGCTCAGCACGGACACTATGACGTGG[T/C]GAGTACACTGTACACACTGCTTCAGCTCCAGACCCGCTGTTCTTCAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45143
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031390 Nonsense 325 1347 9 21
Genomic Location (Zv9):
Chromosome 3 (position 35738637)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35523833
GRCz11 3 35653341
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGTCCAGTCCACATGGCTCACCCACCCCAGCTGGTGGACCCCAGGGT[G/T]GAAGTAGCGAGGAGATCTGGGTGCTGCGCAAGCCTGTGGCAGGTAACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33234
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031390 Essential Splice Site 435 1347 12 21
Genomic Location (Zv9):
Chromosome 3 (position 35735676)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35520872
GRCz11 3 35650380
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGGAGGCGGTGTCCCAGAGGAAAGGGGAGGCACCGCCTGAGGGGAAGG[T/C]AAGAAGACTACTCCGACTTGAAACACACTGACCCCTTGCCTTTCCCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20076
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031390 Nonsense 830 1347 16 21
Genomic Location (Zv9):
Chromosome 3 (position 35732068)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35517264
GRCz11 3 35646772
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGGGATGAGCTGAATGTGCCTGATTCAGGAGGAAAATATGCTACAGTA[C/T]AGCCTAGGGTGGGTCGCAGCAACTCAATGAAGGGACAGGCAGACAAGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14718
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031390 Nonsense 898 1347 16 21
Genomic Location (Zv9):
Chromosome 3 (position 35731862)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35517058
GRCz11 3 35646566
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGAMGTGCCCAAGGAGACTAACAGTGGAYCTCYTCTGGATATTCCCTA[T/A]CAACCACAAAGGCGTGCCAGTGACCTGGGTGGCACTGTAGACACAGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20075
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031390 Nonsense 1083 1347 18 21
Genomic Location (Zv9):
Chromosome 3 (position 35731185)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 35516381
GRCz11 3 35645889
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGCCGTCCCAAGAGCAAAGACAAAGATGCAGAGGAACTTCAAGATGGA[C/T]AGATGCCTGTACCATATGAGAATGGGACAGGCACAATTAAAAGGCGTCCT
Associated Phenotype:
Not determined