Busch Lab

ZMP

si:ch211-283g2.1

Ensembl ID:
ENSDARG00000046091
ZFIN ID:
ZDB-GENE-060531-57
Description:
Transporter [Source:UniProtKB/TrEMBL;Acc:A2CEH5]
Human Orthologue:
SLC6A1
Human Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 1 [Source:HGNC Symbol;Acc:11042
Mouse Orthologue:
Slc6a1
Mouse Description:
solute carrier family 6 (neurotransmitter transporter, GABA), member 1 Gene [Source:MGI Symbol;Acc:M

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20333 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26390
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049197 Nonsense 128 581 3 13
ENSDART00000132130 Nonsense 128 590 3 13
Genomic Location (Zv9):
Chromosome 5 (position 4199124)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3858793
GRCz11 5 4191828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTGGGCCCTCTACTACATGTTCAGCTCTTTTCGGAGTGAGTTGCTTTGG[C/T]AAAACTGCAACAACACGTGGAACACGGTGAACTGCACCGACCAAGTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20333
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049197 Nonsense 495 581 12 13
ENSDART00000132130 Nonsense 504 590 12 13
Genomic Location (Zv9):
Chromosome 5 (position 4164424)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 3824093
GRCz11 5 4157128
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTCTCAGTCATTCAGTTCAAACCAGCGCGGTATGAGGATTATGTGTA[C/A]CCACCGTGGGCTCAGGGTGTTGGCTGGCTCATCGCCCTGGCGTCCATCAT
Associated Phenotype:
Not determined