Busch Lab

ZMP

zgc:110339

Ensembl ID:
ENSDARG00000046030
ZFIN ID:
ZDB-GENE-050417-323
Description:
hypothetical protein LOC550490 [Source:RefSeq peptide;Acc:NP_001017792]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa24617 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24617
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067678 Essential Splice Site 129 255 3 6
Genomic Location (Zv9):
Chromosome 25 (position 10760642)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 10452693
GRCz11 25 10549499
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGAAGACCTACGAGAGCAACACGGTTTCTCCTCTCTTTGTGACCAAG[G/A]TATTAGAGGATTCTATTTTCAGTAGTTGTCCATTGAGGGTTTATCCTCCA
Associated Phenotype:
Not determined