Busch Lab

ZMP

snai1b

Ensembl ID:
ENSDARG00000046019
ZFIN IDs:
ZDB-GENE-980526-514, ZDB-GENE-980526-514
Description:
snail 1b [Source:RefSeq peptide;Acc:NP_571064]
Human Orthologue:
SNAI1
Human Description:
snail homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:11128]
Mouse Orthologue:
Snai1
Mouse Description:
snail homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:98330]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa12537 Nonsense Available for shipment Available now
sa12547 Nonsense Available for shipment Available now
sa19312 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12537
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
Genomic Location (Zv9):
Chromosome 23 (position 2520433)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2567301
GRCz11 23 2505501
KASP Assay ID:
554-6178.1 (used for ordering genotyping assays)
KASP Sequence:
GTGCATTCGCTGACCGCTCGAACCTGCGGGCTCATCTGCAGACSCACKCC[G/T]AGGTGAAGAAGTACCAGTGCGGGTCKTGCTCTCGGAYCTTCAGCCGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12547
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
Genomic Location (Zv9):
Chromosome 23 (position 2520433)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2567301
GRCz11 23 2505501
KASP Assay ID:
554-6178.1 (used for ordering genotyping assays)
KASP Sequence:
GTGCATTCGCTGACCGCTCGAACCTGCGGGCTCATCTGCAGACSCACKCC[G/T]AGGTGAAGAAGTACCAGTGCGGGTCKTGCTCTCGGAYCTTCAGCCGCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19312
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
ENSDART00000067652 Nonsense 225 256 3 3
ENSDART00000123322 Nonsense 224 255 5 5
Genomic Location (Zv9):
Chromosome 23 (position 2520433)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 2567301
GRCz11 23 2505501
KASP Assay ID:
554-6178.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCATTCGCTGACCGCTCGAACCTGCGGGCTCATCTGCAGACCCACTCC[G/T]AGGTGAAGAAGTACCAGTGCGGGTCGTGCTCTCGGACCTTCAGCCGCATG
Associated Phenotype:
Not determined