Busch Lab

ZMP

slc47a1

Ensembl ID:
ENSDARG00000046012
ZFIN ID:
ZDB-GENE-050327-20
Description:
solute carrier family 47, member 1 [Source:RefSeq peptide;Acc:NP_001014332]
Human Orthologues:
SLC47A1, SLC47A2
Human Descriptions:
solute carrier family 47, member 1 [Source:HGNC Symbol;Acc:25588]
solute carrier family 47, member 2 [Source:HGNC Symbol;Acc:26439]
Mouse Orthologues:
Slc47a1, Slc47a2
Mouse Descriptions:
solute carrier family 47, member 1 Gene [Source:MGI Symbol;Acc:MGI:1914723]
solute carrier family 47, member 2 Gene [Source:MGI Symbol;Acc:MGI:3588190]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa14530 Nonsense Available for shipment Available now
sa37366 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa14530
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046317 Nonsense 353 629 13 18
ENSDART00000133604 Nonsense 380 656 13 18
ENSDART00000135235 None None 226 None 8
ENSDART00000137740 None None 150 None 5
ENSDART00000144435 Nonsense 87 363 4 9
Genomic Location (Zv9):
Chromosome 21 (position 38803036)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39943101
GRCz11 21 39966654
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTATCCAGRAGAAAAWATAACTTCAGNNNNNNTCKTTACTRTATTGCAGGGATTT[T/A]GGCTTTTGCACAGGGAATCGGGATCGCTYTGACAAARTCCAAATTAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37366
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046317 Nonsense 384 629 14 18
ENSDART00000133604 Nonsense 411 656 14 18
ENSDART00000135235 None None 226 None 8
ENSDART00000137740 None None 150 None 5
ENSDART00000144435 Nonsense 118 363 5 9
Genomic Location (Zv9):
Chromosome 21 (position 38805053)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39945118
GRCz11 21 39968671
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTCTCACTTCTTGATTTAATCTAACAGGAGCATAGTGGCAATTGTCTCG[C/T]AAAATCTCACGCTGTACGTTTTCCTGCAGTTTTTTGATGCTCTTGTGGTA
Associated Phenotype:
Not determined