Busch Lab

ZMP

zgc:153129

Ensembl ID:
ENSDARG00000045980
ZFIN ID:
ZDB-GENE-061013-189
Description:
hypothetical protein LOC768128 [Source:RefSeq peptide;Acc:NP_001070742]
Human Orthologues:
CSTA, CSTB
Human Descriptions:
cystatin A (stefin A) [Source:HGNC Symbol;Acc:2481]
cystatin B (stefin B) [Source:HGNC Symbol;Acc:2482]
Mouse Orthologues:
2010005H15Rik, BC100530, Csta, Cstb, Gm10092, Gm1975, Gm4758, Gm5416, Gm5483, Gm5689, Stfa1, Stfa2, Stfa2l1, Stfa3
Mouse Descriptions:
RIKEN cDNA 2010005H15 gene Gene [Source:MGI Symbol;Acc:MGI:1924020]
cDNA sequence BC100530 Gene [Source:MGI Symbol;Acc:MGI:3696883]
cystatin A Gene [Source:MGI Symbol;Acc:MGI:3524930]
cystatin B Gene [Source:MGI Symbol;Acc:MGI:109514]
predicted gene 10092 Gene [Source:MGI Symbol;Acc:MGI:3642362]
predicted gene 1975 Gene [Source:MGI Symbol;Acc:MGI:3780144]
predicted gene 4758 Gene [Source:MGI Symbol;Acc:MGI:3648404]
predicted gene 5416 Gene [Source:MGI Symbol;Acc:MGI:3644688]
predicted gene 5483 Gene [Source:MGI Symbol;Acc:MGI:3645124]
predicted gene 5689 Pseudogene [Source:MGI Symbol;Acc:MGI:3647214]
stefin A1 Gene [Source:MGI Symbol;Acc:MGI:106198]
stefin A2 Gene [Source:MGI Symbol;Acc:MGI:106197]
stefin A2 like 1 Gene [Source:MGI Symbol;Acc:MGI:3524944]
stefin A3 Gene [Source:MGI Symbol;Acc:MGI:106196]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26391
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067594 Essential Splice Site 59 101 2 3
Genomic Location (Zv9):
Chromosome 5 (position 4452199)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 4087277
GRCz11 5 4528170
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCATTCTGTTCACCACACAGGTCGTGGCCGGGACCAACTATTTCATCAAG[G/A]TAAATGATGAAGAAGGAAATATAAGGGGGAATTTTAGAGTTGCTAGTACA
Associated Phenotype:
Not determined