Busch Lab

ZMP

zgc:153704

Ensembl ID:
ENSDARG00000045979
ZFIN ID:
ZDB-GENE-060929-1114
Description:
hypothetical protein LOC767759 [Source:RefSeq peptide;Acc:NP_001070194]
Human Orthologues:
LCN15, LCNL1
Human Descriptions:
lipocalin 15 [Source:HGNC Symbol;Acc:33777]
lipocalin-like 1 [Source:HGNC Symbol;Acc:34436]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40351 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40351
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067593 Nonsense 51 184 2 6
Genomic Location (Zv9):
Chromosome 5 (position 4412237)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 4047315
GRCz11 5 4488208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATGACAGGGAAATGGCACCTGATCGGGTTTGCGACCAACGCTGAGTG[G/A]TTCGTCAGCCGTAAGGCCAACATGAAGATGGGCATCGCCATGGTGACGCC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5279
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067593 Essential Splice Site 82 184 3 6
Genomic Location (Zv9):
Chromosome 5 (position 4409811)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 4044889
GRCz11 5 4485782
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATGTGTGCTCTATTAATGTAAAATATTTACCTATTTGTTCTGTCGTTCC[A/T]GTCCTGATGGCACATGCTGGAGAATGAACTATCTGGCTCAGAAGACCGAT
Associated Phenotype:
Not determined