Busch Lab

ZMP

htatip

Ensembl ID:
ENSDARG00000045951
ZFIN ID:
ZDB-GENE-030131-985
Description:
HIV-1 tat interactive protein [Source:RefSeq peptide;Acc:NP_001013327]
Human Orthologue:
KAT5
Human Description:
K(lysine) acetyltransferase 5 [Source:HGNC Symbol;Acc:5275]
Mouse Orthologue:
Kat5
Mouse Description:
K(lysine) acetyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1932051]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40593 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8366
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032909 Nonsense 461 538 13 16
ENSDART00000132183 Nonsense 461 538 13 15

The following transcripts of ENSDARG00000045951 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 69731925)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66057108
GRCz11 5 66736213
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACAGACAATACTGGAGATCCTTATGAAYCTCAAATCAGAGAATGGAGAA[C/T]GRCCACAGATGACCATCAAGTAGGTCATTTGCTCAACAGAAATATCTTTA
Long Flanking Sequence:
CAGAGTATGACTCTAAGGGTTTCCACATAGTCGGCTACTTCTCCAAGGTACATCATTGCTAGGCTTGATTGTTGAATCTCCTTTTTTATACTATAGCCTTATTATGCTGTGTGTGTGTGTGTTTGTGTGTGTTCACTCTTTTGCTGTCCTCCAAATAAAGGAAAAGGAATCAACAGAGGACTATAACGTGGCCTGCATTTTGACTTTACCACCTTACCAGAGAAGAGGCTATGGAAAACTTCTAATTGAGTTTAGTGAGTAATCTTGGCTTTTCATTGAAGAACTAAATTATTGCTCTCATTTGTGTAATAAAACTTAAAATTACATCATGAACATTTGGGCCTTGTTTACATCTTCCAGGTTATGAGCTCTCTAAAGTGGAAGGAAAAACTGGTACTCCAGAGAAGCCTTTGTCTGATCTGGGTCTGCTCTCTTACCGTTCATACTGGTCACAGACAATACTGGAGATCCTTATGAACCTCAAATCAGAGAATGGAGAA[C/T]GACCACAGATGACCATCAAGTAGGTCATTTGCTCAACAGAAATATCTTTAATATAATACTATTTTATTTTATTATTATGTTATTTTGATAAGTATTTTTTACCATTATATTTTGCTTTGACATTATTTTTATAAAAATTCAAAACATAGTCGATACATAGTATTGTGTGTTTTCAGTAAGTGTGTATATATACAGTTGAAGTCAAAATTTTCAGCCCTCCTGTGATGATTTTTTTTTTCTTTCTTTCTTCAAATATTTCCCAAATTATGTTTAACAAGAAATGTTTCACAGTATTTCCTATAATATTTTTTATTCTGGAGAAAGTCTTATTCACTTTATTTAGGCTAGAATAAAAGTAGTTTTCATTTTTTTTTTGAAAGCCATTGCAAGGTCAATGTACTGTCATCATGGCAAAGATAAAATAAATCAGTGCTGATGCTTTTATCCAAGTAACTTCCAAATGAGGATAAAACACAAGTACATTATTAAATTAGTAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40593
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032909 Essential Splice Site None 538 15 16
ENSDART00000132183 None None 538 15 15

The following transcripts of ENSDARG00000045951 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 69729342)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66054525
GRCz11 5 66733630
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTGTGCTGACTGTTGAACTTCCATCTTCCTGACAGAAGAAAAAATTG[T/A]TGAATTGCACAAATGTTTACCCCCTTTTTTTTTGTTCAACCTCGCTGCAA
Long Flanking Sequence:
CTCCTAAAGACTGGAGCAAGAGGGGCAAGTGGTAAACTTTAGGGTCAAATTCATGTCAATCTTGTCAAAAGATCTTCCTAAATACGAAAATGTATGGTCAGTGCCATAAAAACACAACCACAACAGCATTTACATGTTGTTTCCCACCGTTTGTGAATCATATTCAATTTCCAAGGAGAGCTGCTGAAGCGGAGATCAATGAGGACTGGACGCTAATGTGTCCCTCTATGTGCGATACTCTACTGACTCAAGAACAAGAAGTGAGCGTATGTCGATTTTGAGACTTGATATTAAATCAAAGCTACACACTTCAGTTACTTTTGTAATCATACATGTTTTTCCAGCCCCAAAAAAAACCTGCTGGAAACACGTTTTTAACCATATCATAACCACTCGAGTCAGTTCTCACAAACAAGCAGCCTTTGATATAAACAGCATATTTTTAACAACTGCTTGTGCTGACTGTTGAACTTCCATCTTCCTGACAGAAGAAAAAATTG[T/A]TGAATTGCACAAATGTTTACCCCCTTTTTTTTTGTTCAACCTCGCTGCAACTTTGTCGGTTGTGTTGTCAGAAGTCAGCAGACATACCGTACACATAAAAAATGAATAAGATAATGCTGCTTTGTTGTCGTGTTTAGCGGATTATGTGAATGGACTTTACATTGTCATTGTGTCTGTACATAATTTACTACATTTAAAGTAAATGTCTTTTCTACATTGTATTTTTTCCATGGGTTTTTGGATTCCTCATCTTTTTGTTTAGTTTTTTTGTAACGAATGTTAACCAGCAAACACTCTCCACAGCTTCTGTTTTAGGTTAAATAAAAATACAAATGGTCAATTTAATCTGCCTTAATGCTATGGTTCTCAAAGTGGTGGTCGTGAGACAGTAGGGGGGGGGGGGTCGTTTGGTAATTGCCAAAAAATCTCATATTTGATCAACTATTAGAATTAGGGCTGCACGATTAATCAAGAAAAGATCACAATCTCAGTTTGACCCT
Associated Phenotype:
Not determined