Busch Lab

ZMP

sec24d

Ensembl ID:
ENSDARG00000045946
ZFIN IDs:
ZDB-GENE-070117-2501, ZDB-GENE-070117-2501
Description:
SEC24 family, member D [Source:RefSeq peptide;Acc:NP_001171403]
Human Orthologue:
SEC24D
Human Description:
SEC24 family, member D (S. cerevisiae) [Source:HGNC Symbol;Acc:10706]
Mouse Orthologue:
Sec24d
Mouse Description:
Sec24 related gene family, member D (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1916858]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa10908 Nonsense Available for shipment Available now
sa18900 Nonsense Mutation detected in F1 DNA Not yet available
sa9139 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa21148 Nonsense Available for shipment Available now
sa34239 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10908
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035907 None None 278 3 20
ENSDART00000058763 Nonsense 54 1029 3 26
ENSDART00000035907 None None 278 3 20
ENSDART00000058763 Nonsense 54 1029 3 26
Genomic Location (Zv9):
Chromosome 7 (position 72620179)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69672221
GRCz11 7 69913566
KASP Assay ID:
554-6163.1 (used for ordering genotyping assays)
KASP Sequence:
TACAGTGCTTGCAAATCCTGTAATTTACWGTTGATTTTTCAGGTGTGCTC[A/T]AGCCTCCTGCCTCCTCTCCTTCTGGGATGCCTCCACCACCSGTATCCAGC
Long Flanking Sequence:
AGAGTAAATATGACGTTATTCTGTCGTCTGGCTGCTGTTATCAGTCTCGCACTATTTTTTCCTTTTTCTGAAAGTCTTGATTACACCATCGTGGCGTTTTTCTTTTATTAATTCAGCAAATAGCATTGTAAAAAAAACTATTTGTCGTACTCTTCCATTCACTTCGCTCTAAGTTTACCCAGCCATGACGTCTTCCGCTACTGAGAAACCCGGAAATCTGAAAAGGGTCTATAACCCATAAGGACCCTGCTCTTCATTATAGTTTTCCTCATAATACCTTTTGAAGGGCTGCGTGATTATGGCAAAAGTCATTATAGTGATAACTTAACATGATTAAGGCATTATACAGTGCCGCAGTGCCCGTGGATATAACCACCGTCCGTGCATCACAACTGTACATGTTATCATAAATGTTAAATATCTCATGGCCTTAGTGCTCTTTTGTTTTCATACAGTGCTTGCAAATCCTGTAATTTACTGTTGATTTTTCAGGTGTGCTC[A/T]AGCCTCCTGCCTCCTCTCCTTCTGGGATGCCTCCACCACCGGTATCCAGCCAGTATGGCACTAACATTCAGCAGAACGGCGCCCATCCACACAGGTAAAAATGAACTCACTATAATAAAACACTGTTTAAAGTTCTGTTACTATATTGTGTCTAATGCATTTTTTGGTGCTCCCTTCAGTTTCCCTCCTCCAGTTTCTTCATCTCCTTCTATGTCTCCTTATGGTCAGCCTCCTCCAACTGCTTTTCATAGTATGGCACAAGCCCTGCCTCCAACTCAGCAGCTGACCAATCAAATGAGTGCCATGAATATTGCAGGATATGGTAAGCAAGGGTGTCTGTGAGGTCTTAAAATTTTTAAACCGTCCTAAATTTTAAAAAAACAAAGGTGTTGGCCTTAAAAGACACAGAAATATTGTGTTGTAGTTCTCAAATCATGTTAAACGAGTCTTATTTTTTACTATATGTCCATGTTAGACTAAACAATTGGGCCAACACCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18900
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035907 None None 278 3 20
ENSDART00000058763 Nonsense 54 1029 3 26
ENSDART00000035907 None None 278 3 20
ENSDART00000058763 Nonsense 54 1029 3 26
Genomic Location (Zv9):
Chromosome 7 (position 72620179)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69672221
GRCz11 7 69913566
KASP Assay ID:
554-6163.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAGTGCTTGCAAATCCTGTAATTTACTGTTGATTTTTCAGGTGTGCTC[A/T]AGCCTCCTGCCTCCTCTCCTTCTGGGATGCCTCCACCACCGGTATCCAGC
Long Flanking Sequence:
AGAGTAAATATGACGTTATTCTGTCGTCTGGCTGCTGTTATCAGTCTCGCACTATTTTTTCCTTTTTCTGAAAGTCTTGATTACACCATCGTGGCGTTTTTCTTTTATTAATTCAGCAAATAGCATTGTAAAAAAAACTATTTGTCGTACTCTTCCATTCACTTCGCTCTAAGTTTACCCAGCCATGACGTCTTCCGCTACTGAGAAACCCGGAAATCTGAAAAGGGTCTATAACCCATAAGGACCCTGCTCTTCATTATAGTTTTCCTCATAATACCTTTTGAAGGGCTGCGTGATTATGGCAAAAGTCATTATAGTGATAACTTAACATGATTAAGGCATTATACAGTGCCGCAGTGCCCGTGGATATAACCACCGTCCGTGCATCACAACTGTACATGTTATCATAAATGTTAAATATCTCATGGCCTTAGTGCTCTTTTGTTTTCATACAGTGCTTGCAAATCCTGTAATTTACTGTTGATTTTTCAGGTGTGCTC[A/T]AGCCTCCTGCCTCCTCTCCTTCTGGGATGCCTCCACCACCGGTATCCAGCCAGTATGGCACTAACATTCAGCAGAACGGCGCCCATCCACACAGGTAAAAATGAACTCACTATAATAAAACACTGTTTAAAGTTCTGTTACTATATTGTGTCTAATGCATTTTTTGGTGCTCCCTTCAGTTTCCCTCCTCCAGTTTCTTCATCTCCTTCTATGTCTCCTTATGGTCAGCCTCCTCCAACTGCTTTTCATAGTATGGCACAAGCCCTGCCTCCAACTCAGCAGCTGACCAATCAAATGAGTGCCATGAATATTGCAGGATATGGTAAGCAAGGGTGTCTGTGAGGTCTTAAAATTTTTAAACCGTCCTAAATTTTAAAAAAACAAAGGTGTTGGCCTTAAAAGACACAGAAATATTGTGTTGTAGTTCTCAAATCATGTTAAACGAGTCTTATTTTTTACTATATGTCCATGTTAGACTAAACAATTGGGCCAACACCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9139
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035907 Essential Splice Site None 278 None 20
ENSDART00000058763 Essential Splice Site 133 1029 None 26
Genomic Location (Zv9):
Chromosome 7 (position 72620503)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69672545
GRCz11 7 69913890
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTCAGCAGCTGACCAATCAAATGAGTGCCATGAATATTGCAGGATATGG[T/A]AAGCAAGGGTGTCTGTGAGGTCTTAAANNTTTTAAACCGTCCTAAATTTN
Long Flanking Sequence:
TTAACATGATTAAGGCATTATACAGTGCCGCAGTGCCCGTGGATATAACCACCGTCCGTGCATCACAACTGTACATGTTATCATAAATGTTAAATATCTCATGGCCTTAGTGCTCTTTTGTTTTCATACAGTGCTTGCAAATCCTGTAATTTACTGTTGATTTTTCAGGTGTGCTCAAGCCTCCTGCCTCCTCTCCTTCTGGGATGCCTCCACCACCGGTATCCAGCCAGTATGGCACTAACATTCAGCAGAACGGCGCCCATCCACACAGGTAAAAATGAACTCACTATAATAAAACACTGTTTAAAGTTCTGTTACTATATTGTGTCTAATGCATTTTTTGGTGCTCCCTTCAGTTTCCCTCCTCCAGTTTCTTCATCTCCTTCTATGTCTCCTTATGGTCAGCCTCCTCCAACTGCTTTTCATAGTATGGCACAAGCCCTGCCTCCAACTCAGCAGCTGACCAATCAAATGAGTGCCATGAATATTGCAGGATATGG[T/A]AAGCAAGGGTGTCTGTGAGGTCTTAAAATTTTTAAACCGTCCTAAATTTTAAAAAAACAAAGGTGTTGGCCTTAAAAGACACAGAAATATTGTGTTGTAGTTCTCAAATCATGTTAAACGAGTCTTATTTTTTACTATATGTCCATGTTAGACTAAACAATTGGGCCAACACCCATCCAATCACCAAAAATCCAATGCAATGAAACTTTTAATAGAACTCTATACTGTATATACTCTATATATTTATAACTCAATTTACCAATATGGTTTAAATATCTTTCTTACAATAACATTTGTATTTATGGACCATAAATGGTGAGGACACTAGCCTGTACAGACTGTTGTACATGTAGTTTATGATAGTTTCTAAAAACTTGTCAAATACTTTTTAAAGATATGTTATGTTAAAAAAATGCATGTATACAACTAGGCTTTGCTTGTTTTGATGTGGCTAAGATATAACCAATTTGGGCATGTAAAGGCCTAACCAGGCCTATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21148
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035907 None None 278 5 20
ENSDART00000058763 Nonsense 212 1029 5 26
Genomic Location (Zv9):
Chromosome 7 (position 72622213)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69674255
GRCz11 7 69915600
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGACCAGTAGTCCACCAGCCGCCACATGGACCACAGGGATATCCACAG[C/T]AACCCGGTAAAAACTGAGCATCAATGAAAAGCGTGTTATTAAAAGTGTTA
Long Flanking Sequence:
TGCAGTGTAAACAAAGCAGCGACGAAACGCTAGCCCAGATAGTCATGCAGTGTGAAAACATCTGTGACACGACTACTCTGAAAATCATGCAGTCTGAACTCGGCATTACTCGTTAGCCCTGTTTAAGTCTGAAATTTTATTCATAATCGTCTTAAAAAGTCTTATATTTGACTGACACCTGCAGAAACCCTGGATATGTTAAGTTAGATGGCATTTCGTATTCTTTTAAAGCAAATCAACCCATTTTATGCTCTTGATTTTTAGGTCAAAGGCCTGTGCAGTCTCCCTCAAACTCAGCACCAGCACACTTCCAAACTTCACCACCTCCACCTGTGATGGGACATCCACCGCTTTCTCCACCAGGACAGCAGCCGTCTCCTCTAGGATCTCCTCCACCAATGGCCACAATGGGATCTATGCCAGCTCCACCAATGGGAATGTCTGGCCCGCCTGGACCAGTAGTCCACCAGCCGCCACATGGACCACAGGGATATCCACAG[C/T]AACCCGGTAAAAACTGAGCATCAATGAAAAGCGTGTTATTAAAAGTGTTACAATTTAAAGGTAAAGGTTATGTTTTTTTTTATGTTGATATAGTTTCTTCAATTTTTAAAAATTTGAAAGCCTTTTACTCTACTGGTTAAATGCTTATAATGATAATTATGATTTTTAAAAAGCGGAAATTGGAAGTCTTATAATCACCAATGTTAGAATTTTTATATTGATCGGATATATATTAAAACATTAAAAATGTGAAATATCGTAACAATTTAAAAGAACAGTTTTCTTTTTGCTAATACTGTATTTTAAAATGTATTTTATTTCTGGCAGCTGAATTTGTAGCATCTTTACTCTCAAATTAGAATATGAAATAATATTGAAATAACCACCGATATATCATGCATCCCTAAATTGATTTTGTTATTGGACCATCACAAAAATATAAAAAAATAGCCAATATTGATATTGGTGTTGATACTTCATGCATTCCTAAAGTAATTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34239
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035907 None None 278 9 20
ENSDART00000058763 Nonsense 378 1029 12 26
Genomic Location (Zv9):
Chromosome 7 (position 72628520)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69680562
GRCz11 7 69921907
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCGCTGCAAGGCCTACATGTGTCCCTACATGCAGTTTATTGACGGAGGA[C/T]GACGCTTCCAGTGCAGCTTCTGCAGCTGCGTTAATGAAGGTCAGCTCAGC
Long Flanking Sequence:
CTAAACTGTGCAGGGCAGCGGCCCTCCAGGAAAAGAGGGTGACACCCCTGAAATGGATAAATGGATGGAGCTTTCAGCGATTTAGTGGATGGAAGGATAGGATGGATAAGATGGATAGACGAGATAGATATGATGGATGGATAAATAAAATTGATAGATGGATGGATGGATGGATGGATGGATTGTGTGGCTTTGTAGGCAGACAGACAGACAGACAGACAGACAGACAGACAGATAGACAGATAGACAGATAGACAGATAGACAGATAGACAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGAAGGATGTTATATTGTTTTCTTTCTCTCCATCCTCTGCTTGTTCTTTATAGACTCCTCTGTACGTTGTAAATCATGGAGAGACTGGACCAATCCGCTGCAACCGCTGCAAGGCCTACATGTGTCCCTACATGCAGTTTATTGACGGAGGA[C/T]GACGCTTCCAGTGCAGCTTCTGCAGCTGCGTTAATGAAGGTCAGCTCAGCCCTCAGACTACTGATTTTGGAACACTTCAGTCTTGCATATTACAGAGTAAACCAAGGTTGTAGATTTGCTCTTGACATTGATGGGGACCTAAGAATGCAACACCCATCTATCCAATCACAAGCTGTCTTTCTCGCTTATGAAACATGAATAATCCTAATACACTTGAATAAATCAAACACCCCCCATGCTGCAATTGTCACAACACAAAATTTGACTGATTTCAATGTGAATTCGGCTTTTGGGGAGGAATTAATGCGGATGGCTAGAAAGAGAACATGATGTGACGCAGTAATCTTTTTATCTTGATTATCGTATTCACGCTGCTCACATGAAAAACACGTCAGGGTTCTCAACAGTTACGCACATTTTATTGTCAGTGACAATTAAGGGGCCCTATCATACTCCCGGCGCAATATGGCGCAAGGCGCGGCGCAATAGTCTTTTACTAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa1246
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035907 Essential Splice Site None 278 13 20
ENSDART00000058763 Essential Splice Site 535 1029 16 26
Genomic Location (Zv9):
Chromosome 7 (position 72644208)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69696250
GRCz11 7 69937595
KASP Assay ID:
554-1161.1 (used for ordering genotyping assays)
KASP Sequence:
AAGAAGCAAATWCCCTATTCTTGTTGATTTRCTCGTRTTTTGTTTTCTTC[A/T]GCCTTTTAGATCAGATCCCTGACATGTTTGCTGACACCAACGAGAGCGAG
Long Flanking Sequence:
GATAATCTCCCGATAATCTCGCGTCTCCCTCCCGGTCCTCAAATAGGCTACGTCGCGCACCCTTCTCACCCCTCCCCACCACATCCCTCCTCCTCCTCACTCTTTAGACCTGTTGCGCGCACCTTGTCAAACACCACTAAACCACCACCTCTCCTGACAGCTGAGCGGGACTCTGCAAAATAAACCCTTACACTGACCAAAGTGAAGAGAGTTTACTCACACGTGACTTGTTTTACCTCTTTTGGTCCGATTAGAAACTTTGCAGTGTGAAAGCAAACCGCATCAAAGGCAAAGAGCAACAATGTAACATTTGTAATCTCTGTTTCGGAACAACTGTATCGATTCACAGGTGTGAAAGCACCCTAAATCAAATTGTGATGGGTCAAAATGAAGGAACCCAGCGTGTTCTATCACAGAATTGCTCGTTGTTATTATTTTCGATGTTTCAATAAGAAGCAAATTCCCTATTCTTGTTGATTTGCTCGTGTTTTGTTTTCTTC[A/T]GCCTTTTAGATCAGATCCCTGACATGTTTGCTGACACCAACGAGAGCGAGACTGTTTTTGCACCCGTCGTCCAGGCTGGATTGGAGGCACTAAAGGTAGAAAACAAAGCCAAGAAGCTCCACTGTTTACCAAACAATATCTATTACATCAGTCTGTTTGTTCACTCCCTTTCTAAACGCACTTGCACACTTTGCCTCATACGTCAGGTTTGTTTTTATATTGTTTAGCAAAAGGGCACTTTACTACCGCAGGCAGGCTTTGTTTGATAAACACTAAGTTGTTTTTTGGGCTGTTGGTTGAATCCATCGATGTTAGCGCTTGTCATTATTGGCGACCGTGCTGGTGATTTCATAACATCTCTTTAATGAGTGTTTAATGACACATTCAGTCTGTGACCTTACGGTGTTTTGGTCAATGCACTTTATCAGATATTTTAATTAAGTGCACTTGACATGCAGACCTCCCAAGTGAAAAACAAGTACACTTCAGTATACTTGAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5454
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035907 Essential Splice Site 248 278 18 20
ENSDART00000058763 Essential Splice Site 790 1029 21 26
Genomic Location (Zv9):
Chromosome 7 (position 72648145)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69700187
GRCz11 7 69941532
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACAAGAGCTGTGAGACTGACGCGCTCATCAACTTCTTTGCCAAATCAGG[T/A]CAGCAAAACACTTTTCTCAAATCTTAGAAGAATCTACATGAGATMTGCAT
Long Flanking Sequence:
CACTGTTCTAACATTTTGTTTGATGTACAACATTGAAGGCTTCAGGGCGACAGATTTCTTCGGTGCCGTGTACATGAACAACACCACAGATGTGGAGATGGCAGCGGTAGACTGTGATAAGGCTGTGACGGTCGAGTTTAAACATGACGACACACTTAGTGAGGAGTCTGGAGCTGTAATGCAGGTCAGTCTTTTACTTTTGGATAAATAACAACACATGGAATACAAACCTCCAAAAACACTTTCATTTTCACAAATAAATATGATTTTTCAGCTTCAGCTCTCTTCTTACTAGTATTGCTACAATGCTGGAATTCGGTACCAGTCGATACTTATAAATAGTTTGGTCTTGTTTCCCAGTGTGCTTTGCTCTACACCACTATTGGTGGACAGAGACGTCTGCGAATTCACAACCTGAGTCTGAACTGCAGCTCTCAGCTTTCTGAGCTCTACAAGAGCTGTGAGACTGACGCGCTCATCAACTTCTTTGCCAAATCAGG[T/A]CAGCAAAACACTTTTCTCAAATCTTAGAAGAATCTACATGAGATCTGCATACAGCTTATATCCATTTTAGTAATATAATGCTAATATCCAACTATATTTCATTCATAATTTAAAATTTTCCTTAAAACTGGAAGTAGATTTCATTTTAATTTTTCCAAAACTTAGTTCTTACTAATTTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTATTCTGTTCTGTTCTATTCTATTCTATTCTGTTTTATTCTGTTTTATTCTATTCTGTTTTATTCTAGTCTATTCTATTCTACTTTATTTTATTCTATATTATTTTATTCTATTTTATTCTATATTATTTTATTCTATTTTATTCTGTTCTATTTTATTTTAATTTATTTTATTTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Associated Phenotype:
Not determined