Busch Lab

ZMP

syn2a

Ensembl ID:
ENSDARG00000045945
ZFIN ID:
ZDB-GENE-040718-341
Description:
synapsin-2 [Source:RefSeq peptide;Acc:NP_001002597]
Mouse Orthologue:
Syn2
Mouse Description:
synapsin II Gene [Source:MGI Symbol;Acc:MGI:103020]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa10915 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10915
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067531 Essential Splice Site 266 463 6 11
Genomic Location (Zv9):
Chromosome 23 (position 4812989)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 4821688
GRCz11 23 4757273
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CATTTCCCGTTGTCGTGAAAATTGGACACGCTCACTCTGGTGTGGGGAAG[G/A]TAACATTTAACCTTAAACCATGACTGTAAAGAAGAGATGTGCACTTCRTG
Associated Phenotype:
Not determined