Busch Lab

ZMP

immp1l

Ensembl ID:
ENSDARG00000045935
ZFIN ID:
ZDB-GENE-070522-4
Human Orthologue:
IMMP1L
Human Description:
IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) [Source:HGNC Symbol;Acc:26317]
Mouse Orthologue:
Immp1l
Mouse Description:
IMP1 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:191

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa20884 Nonsense Available for shipment Available now
sa844 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20884
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114062 Nonsense 54 189 2 6
Genomic Location (Zv9):
Chromosome 7 (position 16816822)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15799520
GRCz11 7 16051493
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGGCTACACCGTCCAGTATGGCTGCATCGCTCACTGCGCCTTTGAATA[T/A]GTTGGTGAATTTGTATCGGTAGGTTTTTTTTTTTTGTCGTTGTGGGGGGG
Long Flanking Sequence:
AAGGTTTATGCTATTTATATTTAACTTTTTAAAATGAAATAAAAAAATATTAATACGTTTTATTGTTATGCAGCTGATGGTAATTTGATTTAAAATTACAAGCGCTGAGCAAATGGATGCATGGAGAAATTGTTCACAATGACATAACTATATATATATATATATTTTTTTTTTCTTTCTTTTTTAATGAAAATGCCAACATGGAAATTCCCTTTCCTATCAGTTTTTGCTACTCTTACTAAAAAAAAAAAAATTACTCGGTTTTAATCTCACACTTTAATATTATTAACCTGATCAACTGAAAACTCGATATCACGTGTATGATAATAGCAGCATTGGTAGAGAATGATTGATTATTACATTTAGACTTTTTTCATTTTTGCAGAATTGCTGATTGTCATTAAGAGTGTCAGGATGTTTCGTGGTTTCTTTGTGAAGACGATCAGCTTTGTTGGCTACACCGTCCAGTATGGCTGCATCGCTCACTGCGCCTTTGAATA[T/A]GTTGGTGAATTTGTATCGGTAGGTTTTTTTTTTTTGTCGTTGTGGGGGGGATGTTTAATCATAGCATTTTAGCATCGAGTAGAAAAAGAAACACATAAATCATGTTTTTTTTAACAACTATTTATGTCCAAAAGTGTTCAGGTCCTTCCATGGAGCCCACCATTACTAACCATGATGTGGTTTTCTCAGAACGAATAAGCCGCCACCTCTACCGCATACAAAAGTTAGTATGCTCGATTTGAATTTAGTGTATTTCAAGTGTACTGTGCATTTATTTTGTTACTTTTTTTTCAGAGGGGATATTATAATAGCCAAAAGTCCTTCTAATCCCAAGATGAACATTTGTAAAAGAGTAATCGGGCTGGAGGGGGACAAGGTCTGCACCAGCGGACCATCTGACATCTTTAAAACACACACTTATGTAAGTACCACCACACCTGACATAATACAAAAACTTTATATAATATACTGTACACAGGGACACTTTATGATTATAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa844
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114062 Splice Site, Nonsense 132 189 4 6
Genomic Location (Zv9):
Chromosome 7 (position 16817243)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15799941
GRCz11 7 16051914
KASP Assay ID:
554-0747.1 (used for ordering genotyping assays)
KASP Sequence:
GACAAGGTCTGCWCCAGCGGACCATCTGACATCTTTAAAACACACACTTA[T/A]GTAAGTACCACCACACCTGACATAATACAAAAACTTTATATAATATACTG
Long Flanking Sequence:
GTGGTTTCTTTGTGAAGACGATCAGCTTTGTTGGCTACACCGTCCAGTATGGCTGCATCGCTCACTGCGCCTTTGAATATGTTGGTGAATTTGTATCGGTAGGTTTTTTTTTTTTGTCGTTGTGGGGGGGATGTTTAATCATAGCATTTTAGCATCGAGTAGAAAAAGAAACACATAAATCATGTTTTTTTTAACAACTATTTATGTCCAAAAGTGTTCAGGTCCTTCCATGGAGCCCACCATTACTAACCATGATGTGGTTTTCTCAGAACGAATAAGCCGCCACCTCTACCGCATACAAAAGTTAGTATGCTCGATTTGAATTTAGTGTATTTCAAGTGTACTGTGCATTTATTTTGTTACTTTTTTTTCAGAGGGGATATTATAATAGCCAAAAGTCCTTCTAATCCCAAGATGAACATTTGTAAAAGAGTAATCGGGCTGGAGGGGGACAAGGTCTGCACCAGCGGACCATCTGACATCTTTAAAACACACACTTA[T/A]GTAAGTACCACCACACCTGACATAATACAAAAACTTTATATAATATACTGTACACAGGGACACTTTATGATTATAATGCTATGAATAGACGGAAGGGTCAAAATATGAATAAATAAGTCCTGACTTTTGATTTCTTGATCACACAAATTAACATTTATGTCAAATTTTGTTTATAATTGACAATATTTAAAGGGTCAGGTCACCCAAAACTGAAAATTTTACAAATATCTTCCAACGTTTTTCAAAATATCTTTTATTATTTTTTTCCAACTTTCTTTACAAATATCTTCCAAAGTTCTTCAAATATCTTTTATTTTTTTCCAACTTTCTTTCCAAATAATAATGTTTTTCTTCAACTTTTTCCAAATATCGTCCAACATTCTTCCAAATATCTTAATTTTTTCTTCAACTTTTTCCAAATATCGTCCAAAATTCTTCCAAATATCTTAATTTTTTCTTTCAACTTTCATTCTGAATATCTTCCAATATTCTTTAAAATA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

This allele has been removed from public view.

Allele Name:
sa557
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114062 Nonsense 174 189 6 6
Genomic Location (Zv9):
Chromosome 7 (position 16829888)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 15812586
GRCz11 7 16064559
KASP Assay ID:
554-0467.1 (used for ordering genotyping assays)
KASP Sequence:
TGCAAAGGAATTATTTCTTGTTTGTTTTTATTTTGCAGTTGTGGCCGCCG[C/T]AGAGTTTTGGTGTATTGGCTGAGAGTCCTAACGATGGACGTATTTTATGA
Long Flanking Sequence:
AGAAAAAGTTTAGTCACATTAACATCTGACTATTTTTTAAAATGGTTATGTGTCTTTTTATACAGTGTATGTAAACTTCTGGTTTCAACTGTATACACTTGTAAATAGGTTCATATATATCTGCATACCCTGATTATTAATAGCAACCTGTACATATATTCATCTATTGTAAATCTCTTCATGGTTAATACAACCAATTTATAATGTTAATAGTACATCCAACTGTAAATATCACCATAGTTTTTCTATAACTGCACTTTATAATTTATACCTGTATCCTGCACTTGCTGCTATTGCACTCCTGGCTAGACCTAAATTGCATTTCGTTGCCTTGTACGTGTGTAATGACAATAAAGCTGAATCTAATCTAATCTAATCTGATTATAGTGGTATTATTGATTTTTATACAGCATTATCGTTTAACCTCTTATATTAAAATGTAACTGAAATTGCAAAGGAATTATTTCTTGTTTGTTTTTATTTTGCAGTTGTGGCCGCCG[C/T]AGAGTTTTGGTGTATTGGCTGAGAGTCCTAACGATGGACGTATTTTATGAAGAAGCTCTGCCCATGTATATCTGATGTAAATTATATTTTTCCAGTGTTTTAAAATAAATGCATATTTATAATTCATGTCTGTGTCATTGCACTCAGTGGTTTAGTGAAAATATGTGACAGCAGGTACATTTTTTGGAAAATTGAAATTAATACACAGGCCCGGTTCTTGCCAACCACATAAAGGTGGGCTGACAGAAATCTGAGGTGGGCAATTTTTGGGGGTGGGGTTAGGAGATGGAATAGCAAAAATATTGATGTAATAATATTGTTTGGAGTTGCATATTATATTAAGTCAATATAAGCACAAATATGGTTTCACAAATATTTTGTATTATCAAATATGGTTTCATATAAGAGTTATTTTTAAATCCAATCAACATTCAGAATGGATGATTACTGGACTAATAAGTCCAAATATTCAAGCAATATTATAATGTTTTAAAAGATAG
Associated Phenotype:
Not determined