Busch Lab

ZMP

Q5U400_DANRE

Ensembl ID:
ENSDARG00000045921
Description:
Zc3hdc1l protein [Source:UniProtKB/TrEMBL;Acc:Q5U400]
Human Orthologue:
ZC3HAV1
Human Description:
zinc finger CCCH-type, antiviral 1 [Source:HGNC Symbol;Acc:23721]
Mouse Orthologue:
Zc3hav1
Mouse Description:
zinc finger CCCH type, antiviral 1 Gene [Source:MGI Symbol;Acc:MGI:1926031]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa43346 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa23600 Essential Splice Site Available for shipment Available now
sa8545 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3039
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067497 Nonsense 37 782 1 12
Genomic Location (Zv9):
Chromosome 19 (position 46825486)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16365
GRCz11 4 279765
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCATCGCCTATGCGGACCTGCTGTCTGCTCTGGGCATGTATGATGAGGCT[C/T]AGGATGTCCTGGATGTGCTSATCAGCCGCAGTGARAACTGCACGGTCGGC
Long Flanking Sequence:
AAATGAAAAACAACACAGACAAAATCATTAAAAACATTGAAAATGTGTTAAAACAGATTTTAAAGGAATATATTATATTACTGCGACTTTGCTGTATCCCTTCTAAACTGTTTGCTTAAAGGGTTGATGGTAGAAGGGATACAGCTGCGGCCGGAAGTCAACGATAATTATGAATATTATTATTTATCAAATTACCCATTAACTTGTATTTTAAAAACCCTTATCCTTATTTCAACCATCACGGTAATGTAAAAATTATATTTATTATTCTACATTGTCACAAAAATGACGCGCAGCTGTATCCCTTCTAACCTTTAAGTTTCGTTTTCCTTTCGTGTTGTCCGCCGTCAGAATCAGATGATGAACTGAACTGAACTGAACTGCTCCAGACTCGGTTGTGCAGCATGACGGAGGCGGCGATTATTAAGAATATCTGCGCTAATAACGGCTCCATCGCCTATGCGGACCTGCTGTCTGCTCTGGGCATGTATGATGAGGCT[C/T]AGGATGTCCTGGATGTGCTCATCAGCCGCAGTGAGAACTGCACGGTCGGCTTCTTCAGCGGACAGAAGCGAGTCATCGTCCGTACCAAAGTGCGCCTGTGTCGGATTCAGAACTGCCCCGCCTGCGACAACCTGCACCTGTGCAAAGGCTTTCTGTTCGGGTTTTGCCGTTTCGACAGAGGAAGGTAGATCTGCTTATTAACTAAAATATACTGTTTATTGAATTGAACTGTTTTTAAAACCCGATAGATTCGAATTATCTAGGGAGTCATACATCAAATGACTCGCGAGTCACTTGACTTCCCGTATGAAAACATAGTAATACTGAATTATACAATAGTGAAGTAGTTGATTTAATCTATAATTTTGGCAATTCTACAGTTGCTATCATAACCCTTGATTAAATATTAATTATGATTTAAGTAATCACTGAAGGCATAGGGAGTCATAAATCAAATGACTCACGAGTCACTTCCCTATTGTGTAGCCTACGGTTGATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4076
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067497 Nonsense 60 782 1 12
Genomic Location (Zv9):
Chromosome 19 (position 46825555)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16434
GRCz11 4 279834
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TSATCAGCCGCAGTGARAACTGCACGGTCGGCTTCTTCAGCGGACAGAAG[C/T]GAGTCATCGTCCGTACCAAAGTGCGCCTGTGTCGGATTCARAACTGCCCC
Long Flanking Sequence:
ATATTATATTACTGCGACTTTGCTGTATCCCTTCTAAACTGTTTGCTTAAAGGGTTGATGGTAGAAGGGATACAGCTGCGGCCGGAAGTCAACGATAATTATGAATATTATTATTTATCAAATTACCCATTAACTTGTATTTTAAAAACCCTTATCCTTATTTCAACCATCACGGTAATGTAAAAATTATATTTATTATTCTACATTGTCACAAAAATGACGCGCAGCTGTATCCCTTCTAACCTTTAAGTTTCGTTTTCCTTTCGTGTTGTCCGCCGTCAGAATCAGATGATGAACTGAACTGAACTGAACTGCTCCAGACTCGGTTGTGCAGCATGACGGAGGCGGCGATTATTAAGAATATCTGCGCTAATAACGGCTCCATCGCCTATGCGGACCTGCTGTCTGCTCTGGGCATGTATGATGAGGCTCAGGATGTCCTGGATGTGCTCATCAGCCGCAGTGAGAACTGCACGGTCGGCTTCTTCAGCGGACAGAAG[C/T]GAGTCATCGTCCGTACCAAAGTGCGCCTGTGTCGGATTCAGAACTGCCCCGCCTGCGACAACCTGCACCTGTGCAAAGGCTTTCTGTTCGGGTTTTGCCGTTTCGACAGAGGAAGGTAGATCTGCTTATTAACTAAAATATACTGTTTATTGAATTGAACTGTTTTTAAAACCCGATAGATTCGAATTATCTAGGGAGTCATACATCAAATGACTCGCGAGTCACTTGACTTCCCGTATGAAAACATAGTAATACTGAATTATACAATAGTGAAGTAGTTGATTTAATCTATAATTTTGGCAATTCTACAGTTGCTATCATAACCCTTGATTAAATATTAATTATGATTTAAGTAATCACTGAAGGCATAGGGAGTCATAAATCAAATGACTCACGAGTCACTTCCCTATTGTGTAGCCTACGGTTGATTTAGTATCCTCACATGAAGAAAAATACTGAACCATACTACAGAAAGATACCTGCATTCATCTGTTTTGGTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3040
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067497 Nonsense 158 782 3 12
ENSDART00000067497 Nonsense 158 782 3 12
Genomic Location (Zv9):
Chromosome 19 (position 46828177)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19056
GRCz11 4 282456
KASP Assay ID:
2261-3720.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCAGGTGTGTCACTCCTATARTAATGGCRTGGGTGAGTACGGCCGCTG[T/A]CYGGACGCGGAGGCCTGTAAGCGGCTGCACATCTGYGAGCGCTACCTGCA
Long Flanking Sequence:
CCCAAGAAGTAGCTGTCAGTTTCATAAAGTTTGGTGACCCCTGCTCTAAACCGTGTCAACATAATGGAGTCAGATTGAGCTCAGAAGCGTGATGACTGTGTTTTGCTCCACAGGAGAGGATGCCGCTTCAGTCATGATCTCGATTCTGCTCATAATCTGATGGTTCTGATGGCTAACGGCCTGAACACACTCGACCTGAAAGAGCTGCGGATCCTGCTTCTGCAGAGCGACAACACACTCCTGCCGGCGGTGAGCACACACACACACACACACACACACACACTACAGTTCGAGGTCAATAATATAATCTATTCCATCACACACTAATGTTAACCTGATCTGCTTCCGGATCAGATTTATTAGCATGAGTTTGCCTGAATTAGATACTGATGTCAGATACTGGGGTCTACAGTGGTCTAACCAGCAGTGGTCTAATGAAGCAGGTGTGTTTCTCAGGTGTGTCACTCCTATAATAATGGCGTGGGTGAGTACGGCCGCTG[T/A]CTGGACGCGGAGGCCTGTAAGCGGCTGCACATCTGCGAGCGCTACCTGCAGGGTCACTGCGACTGCACGCGCGCTCACGACTTCTACGAACCGCATCCGCTGAAGACGCTGCAGGACCGCGGCGTCCCTACTGAGCTCATGGCCCTGATGAAGGATCTGTACTCCAACATCGAGGCCCTGCGGCGGACCAACAGGAACAAACCAAACACGGCTCCAAACAACAGGAGAGGCCCGAATGTGAACAACCGCAGGTCATCCAGTGTGGAGTTTACTGCAGCCAACAGAGAAACTGAGGCGACTCAGCACACTTACACTGGTAACACACACTCACAAATTCACTAAAAGTGTGTGTGTGTGTGTGTGTGTGTTTTTTTTGATTGTTTTATTTAATTTTATTTTTACTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19221
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067497 Nonsense 158 782 3 12
ENSDART00000067497 Nonsense 158 782 3 12
Genomic Location (Zv9):
Chromosome 19 (position 46828177)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 19056
GRCz11 4 282456
KASP Assay ID:
2261-3720.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCAGGTGTGTCACTCCTATAATAATGGCGTGGGTGAGTACGGCCGCTG[T/A]CTGGACGCGGAGGCCTGTAAGCGGCTGCACATCTGCGAGCGCTACCTGCA
Long Flanking Sequence:
CCCAAGAAGTAGCTGTCAGTTTCATAAAGTTTGGTGACCCCTGCTCTAAACCGTGTCAACATAATGGAGTCAGATTGAGCTCAGAAGCGTGATGACTGTGTTTTGCTCCACAGGAGAGGATGCCGCTTCAGTCATGATCTCGATTCTGCTCATAATCTGATGGTTCTGATGGCTAACGGCCTGAACACACTCGACCTGAAAGAGCTGCGGATCCTGCTTCTGCAGAGCGACAACACACTCCTGCCGGCGGTGAGCACACACACACACACACACACACACACACTACAGTTCGAGGTCAATAATATAATCTATTCCATCACACACTAATGTTAACCTGATCTGCTTCCGGATCAGATTTATTAGCATGAGTTTGCCTGAATTAGATACTGATGTCAGATACTGGGGTCTACAGTGGTCTAACCAGCAGTGGTCTAATGAAGCAGGTGTGTTTCTCAGGTGTGTCACTCCTATAATAATGGCGTGGGTGAGTACGGCCGCTG[T/A]CTGGACGCGGAGGCCTGTAAGCGGCTGCACATCTGCGAGCGCTACCTGCAGGGTCACTGCGACTGCACGCGCGCTCACGACTTCTACGAACCGCATCCGCTGAAGACGCTGCAGGACCGCGGCGTCCCTACTGAGCTCATGGCCCTGATGAAGGATCTGTACTCCAACATCGAGGCCCTGCGGCGGACCAACAGGAACAAACCAAACACGGCTCCAAACAACAGGAGAGGCCCGAATGTGAACAACCGCAGGTCATCCAGTGTGGAGTTTACTGCAGCCAACAGAGAAACTGAGGCGACTCAGCACACTTACACTGGTAACACACACTCACAAATTCACTAAAAGTGTGTGTGTGTGTGTGTGTGTGTTTTTTTTGATTGTTTTATTTAATTTTATTTTTACTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43346
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067497 Essential Splice Site 419 782 7 12
Genomic Location (Zv9):
Chromosome 19 (position 46832144)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22922
GRCz11 4 274775
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACAGGCCTGGTGTTCAGGACTAATATATAGTGAATCTGTCCTTCTCCTC[A/T]GACATGATCCAAACAAACAAGCAGTACAAAACCAAAAAAGTGATCAGACG
Long Flanking Sequence:
CTCCTTCATCCTGACCACCGAGTGGCTCTGGTTCTGGGAGGACGAGTTTGGAAACTGGATCCAGTACGCCAGCGCGGACGGCGGCCATAAGATATCCTCCATCACCAGTGCAGAGCTGGAGCAGAAATATCAGGCGGACCAGAGCGCAGTGCTGGAGTTCAGCGCCGGGTCACAGACGTACACGCTCAGCTTCCAGGGTAAACACACACATCTCATCATCACACTGGCACACTTACTGTCCTCCAAAAATCCTCCAATAATCTCATATCCGGATAGTGATATATAGCATGTATATATAGCCAGATCTGTCCGTTCACCTGAATGAATGGTCTATCTAAATTGGACACCTGTACAGGACTGCATCTTAATATAAAGTGCATAAACACTACAGCGTAATATCAAACGGCAGACTCTTTAATTCATCCACACGACACATATATCATCATATTGCACAGGCCTGGTGTTCAGGACTAATATATAGTGAATCTGTCCTTCTCCTC[A/T]GACATGATCCAAACAAACAAGCAGTACAAAACCAAAAAAGTGATCAGACGCCGCCCCAAATTCGTCTCCGCCGCAGATGTGAAGACGATCAAGAGCACGTGAGGATGACTGCACACTCCTTCTCTCTGTCAGACTCTATGAATGCTGATTAATCTCTGATATCTCCTCCTGTGCTCTCAGGAAACGAGCACCAATCAGCTTCAAGACTCTGCCGGAGCACTGGGACAAAGCGCTGACTCCTGAAACGGGATGCAAGGTTTGAGGACTATAAAGACTCTCGTTCACAACAAACACCATCACTATAAAGATATAGGTGTAATAATGTGTGACAGTGTTTACCAGCTGAGGAAGAATGAAACACTGACAGCCAATTAGAATCCAGTAAAACACTGACAGCCAATCAGCAGATTAAAGACAGGAGCAGAGAAGAGAGCGCTCTTTCATTATCACAGCTGTCTATCAATGCCAACGTGTGCAGTGTAAATGCAAATATACAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23600
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067497 Essential Splice Site 477 782 9 12
Genomic Location (Zv9):
Chromosome 19 (position 46832733)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23511
GRCz11 4 274186
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATATATATAGTGATGAGTTTGGTATATAACTCTATATGTGTGTTGACGC[A/G]GAGAGTGCAGCTGACAAAAACCACAGCCGAATTCATCAAAATACAGGAGC
Long Flanking Sequence:
TCAAGAGCACGTGAGGATGACTGCACACTCCTTCTCTCTGTCAGACTCTATGAATGCTGATTAATCTCTGATATCTCCTCCTGTGCTCTCAGGAAACGAGCACCAATCAGCTTCAAGACTCTGCCGGAGCACTGGGACAAAGCGCTGACTCCTGAAACGGGATGCAAGGTTTGAGGACTATAAAGACTCTCGTTCACAACAAACACCATCACTATAAAGATATAGGTGTAATAATGTGTGACAGTGTTTACCAGCTGAGGAAGAATGAAACACTGACAGCCAATTAGAATCCAGTAAAACACTGACAGCCAATCAGCAGATTAAAGACAGGAGCAGAGAAGAGAGCGCTCTTTCATTATCACAGCTGTCTATCAATGCCAACGTGTGCAGTGTAAATGCAAATATACAGTCACAAACAATCAGATGTGCAGGTTATGAGTGATATATATATATATATATAGTGATGAGTTTGGTATATAACTCTATATGTGTGTTGACGC[A/G]GAGAGTGCAGCTGACAAAAACCACAGCCGAATTCATCAAAATACAGGAGCTGTTCAACCGCACCATGCGGGGATTCACCATCCAGAATATCGAGAGGATCCAGAACAAAGCATTGTGGGAGGTGTTCCAGTGGTGAGTCCATCACAGCACTGACTTATATAACATCCTGAAAGTTGTGTGCACCTGCTTTGAAGACATTTTGACTGCGTAACAGGAGCGTAACAGTGTCCTGTTGCATAGTTCCGTGTCCTGTCAATCATCTCAACACACCATTCACATTTCTGTCATGTTTAAAGTCATCGTGAACTCAAAATAAAGGGATATAAATGTTAGTTTTAAGGATATATATAATCTAGTGTGCTCAAATTCCCATTAGGATGAAATAAACCTGATATAAACGTCTTAATCATGCAGTTTTTCTCTTCCTTCTAAATCATGAATGCTTTATTTTGATGTTGTCTTATAGTAGATCTTCTGACCAATCAGATGCTCTCTAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8545
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067497 Splice Site, Nonsense 520 782 9 12
Genomic Location (Zv9):
Chromosome 19 (position 46832865)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 23643
GRCz11 4 274054
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAGAWKATCGAGAGGATCCAGAACAAAGCATTGTGGGAGGTGTTCCAGT[G/A]GTGAGTCCATCACAGCACTGACTTRTATWACATCCTGAAAGNTRTGTGCA
Long Flanking Sequence:
TGGGACAAAGCGCTGACTCCTGAAACGGGATGCAAGGTTTGAGGACTATAAAGACTCTCGTTCACAACAAACACCATCACTATAAAGATATAGGTGTAATAATGTGTGACAGTGTTTACCAGCTGAGGAAGAATGAAACACTGACAGCCAATTAGAATCCAGTAAAACACTGACAGCCAATCAGCAGATTAAAGACAGGAGCAGAGAAGAGAGCGCTCTTTCATTATCACAGCTGTCTATCAATGCCAACGTGTGCAGTGTAAATGCAAATATACAGTCACAAACAATCAGATGTGCAGGTTATGAGTGATATATATATATATATATAGTGATGAGTTTGGTATATAACTCTATATGTGTGTTGACGCAGAGAGTGCAGCTGACAAAAACCACAGCCGAATTCATCAAAATACAGGAGCTGTTCAACCGCACCATGCGGGGATTCACCATCCAGAATATCGAGAGGATCCAGAACAAAGCATTGTGGGAGGTGTTCCAGT[G/A]GTGAGTCCATCACAGCACTGACTTATATAACATCCTGAAAGTTGTGTGCACCTGCTTTGAAGACATTTTGACTGCGTAACAGGAGCGTAACAGTGTCCTGTTGCATAGTTCCGTGTCCTGTCAATCATCTCAACACACCATTCACATTTCTGTCATGTTTAAAGTCATCGTGAACTCAAAATAAAGGGATATAAATGTTAGTTTTAAGGATATATATAATCTAGTGTGCTCAAATTCCCATTAGGATGAAATAAACCTGATATAAACGTCTTAATCATGCAGTTTTTCTCTTCCTTCTAAATCATGAATGCTTTATTTTGATGTTGTCTTATAGTAGATCTTCTGACCAATCAGATGCTCTCTAGTGTCTGGAATGCCCCGCCCCTTTTTTATCATTGGCTGTTCATTTGATGTGCTTGAGCTTAACCTCTCGTTGGCAGAGCTGGGAGTAAAAACAGCACGCTATTGGCTGATTTTTAAAAAGGGGAGGAGCTACACTG
Associated Phenotype:
Not determined