Busch Lab

ZMP

nr2e3

Ensembl ID:
ENSDARG00000045904
ZFIN ID:
ZDB-GENE-041114-63
Description:
photoreceptor-specific nuclear receptor [Source:RefSeq peptide;Acc:NP_001007369]
Human Orthologue:
NR2E3
Human Description:
nuclear receptor subfamily 2, group E, member 3 [Source:HGNC Symbol;Acc:7974]
Mouse Orthologue:
Nr2e3
Mouse Description:
nuclear receptor subfamily 2, group E, member 3 Gene [Source:MGI Symbol;Acc:MGI:1346317]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa15662 Nonsense Available for shipment Available now
sa30255 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19364
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067474 Essential Splice Site 109 419 4 8
ENSDART00000127099 Essential Splice Site 116 426 4 8
ENSDART00000067474 Essential Splice Site 109 419 4 8
ENSDART00000127099 Essential Splice Site 116 426 4 8
Genomic Location (Zv9):
Chromosome 25 (position 22998934)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22178047
GRCz11 25 22275595
KASP Assay ID:
554-6231.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCTGCCCTTATTGTCTTCACTTTCTTAACCGTTCCGTTCAATCTTCTC[A/T]GCTGTTCAGAATGAACGTCAGCCCCGCAGCACTGCACAAGTCAGATTAGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4327
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067474 Essential Splice Site 109 419 4 8
ENSDART00000127099 Essential Splice Site 116 426 4 8
ENSDART00000067474 Essential Splice Site 109 419 4 8
ENSDART00000127099 Essential Splice Site 116 426 4 8
Genomic Location (Zv9):
Chromosome 25 (position 22998934)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22178047
GRCz11 25 22275595
KASP Assay ID:
554-6231.1 (used for ordering genotyping assays)
KASP Sequence:
TTTCTGCCCTTATTGTCTTCACTTTCTTAACCGTTCCGTTCAATCTTCTC[A/T]GCTGTTCAGAATGAACGTCAGCCCCGCAGCAYTGCACAAGTCAGATTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15662
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067474 Nonsense 339 419 6 8
ENSDART00000127099 Nonsense 346 426 6 8
Genomic Location (Zv9):
Chromosome 25 (position 23001063)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22180176
GRCz11 25 22277724
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCAAGTGGATCCAACYGAGTTTGCCTGCTTGAAAGCCATTGTTTTGTTC[A/T]AACCAGGTACATTTTGGCTTCTTTTTACCACAAGGGGGCATAAGTGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30255
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067474 Essential Splice Site 376 419 None 8
ENSDART00000127099 Essential Splice Site 383 426 None 8
Genomic Location (Zv9):
Chromosome 25 (position 23001368)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 22180481
GRCz11 25 22278029
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACACTATTCATGAGAGAAGGTTGAACTAACACAGATTATGTTTTTCTT[A/G]GGTTTGGGAGACTATTACTTCTCCTTCCCTCCCTTCACTTTGTGAGCTCA
Associated Phenotype:
Not determined