Busch Lab

ZMP

agbl5

Ensembl ID:
ENSDARG00000045900
ZFIN ID:
ZDB-GENE-040822-29
Description:
Cytosolic carboxypeptidase-like protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q68EI3]
Human Orthologue:
AGBL5
Human Description:
ATP/GTP binding protein-like 5 [Source:HGNC Symbol;Acc:26147]
Mouse Orthologue:
Agbl5
Mouse Description:
ATP/GTP binding protein-like 5 Gene [Source:MGI Symbol;Acc:MGI:2441745]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa12210 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12210
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103601 Nonsense 186 885 5 16
Genomic Location (Zv9):
Chromosome 4 (position 460482)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 740338
GRCz11 4 753786
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGTTAGTGTGTGTGTGTGTGTNNNNTTTCAGTCCTCCAGAGAGCATCTATTA[T/A]CACCGTGAGCTGCTCTGTCACTCTCTGGACGGCCACCGTGTGGATCTGAT
Associated Phenotype:
Not determined