Busch Lab

ZMP

si:dkey-97m3.4

Ensembl ID:
ENSDARG00000045873
ZFIN ID:
ZDB-GENE-060503-462
Human Orthologue:
FRS2
Human Description:
fibroblast growth factor receptor substrate 2 [Source:HGNC Symbol;Acc:16971]
Mouse Orthologue:
Frs2
Mouse Description:
fibroblast growth factor receptor substrate 2 Gene [Source:MGI Symbol;Acc:MGI:1100860]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26195
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067423 Essential Splice Site 23 485 2 6
Genomic Location (Zv9):
Chromosome 4 (position 1954190)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2243897
GRCz11 4 2093210
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAGTGAAGGTGTGTAGATGCTGACAGTGCTCTGTGTGTGTGTGTGTGTA[G/T]GTGATAAACGTGGATGATGATGGTAATGAGCTGGGCTCAGGTGTGATGGA
Associated Phenotype:
Not determined