Busch Lab

ZMP

si:ch211-239h19.1

Ensembl ID:
ENSDARG00000045870
ZFIN ID:
ZDB-GENE-041210-25
Description:
Novel protein similar to vertebrate phosphoinositol 3-phosphate-binding family protein [Source:UniPr
Human Orthologue:
PLEKHA5
Human Description:
pleckstrin homology domain containing, family A member 5 [Source:HGNC Symbol;Acc:30036]
Mouse Orthologue:
Plekha5
Mouse Description:
pleckstrin homology domain containing, family A member 5 Gene [Source:MGI Symbol;Acc:MGI:1923802]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa20181 Essential Splice Site, Missense Available for shipment Available now
sa38416 Nonsense Mutation detected in F1 DNA Not yet available
sa40204 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20181
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067414 Essential Splice Site 127 1136 7 30
ENSDART00000112210 Essential Splice Site 202 1237 7 26
ENSDART00000127894 Essential Splice Site 131 1166 5 24
ENSDART00000135701 Missense 83 84 5 5
ENSDART00000141952 Essential Splice Site 129 1138 4 27
Genomic Location (Zv9):
Chromosome 4 (position 2873452)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3072331
GRCz11 4 3002442
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAGAAGAGATGGTTCGTTCTGTCTGATATGTGCCTCTTCTACTACAGAG[G/T]TGAGTTCAGCATCTCTGTTTACACTTACACACTCATTTTATCAATGCACC
Long Flanking Sequence:
AGCTTAAACCCCTCACAAGTGTCATTTCTCTAAATAATAATGTGCTCTCTGTGTGTCTGCAGCCATCCCGGTCCTCAAAGAAAGTGCACAACTTTGGGAAAAGGTCCAACTCCATCAAGAGGAACCCCAATGCACCTGTGATCAAAAACGGCTGGCTTCACAAACAGGTACTTATCAGTGGGAAACATCCATATGCACTCATTCACACACACAAATGGACAATTTAGCCTATAGCGCATGTCTTTTGGAAACAGGAGCACCCAGAGGAAACCCATGCCAACACGGGGAGAACATGCAAACTCCACACTAACATATTGATACAAACACTCCAAAAACCCTTGAGTGCATTGTTTGGGGGAGGGCTTTCTGTACTTGTGATTGGCTGGCTGATTTGATTGACAGTTCTTGTGCTGCTGGTGTTTTTCAGGACAGCACTGGGATGAAGATGTGGAAGAAGAGATGGTTCGTTCTGTCTGATATGTGCCTCTTCTACTACAGAG[G/T]TGAGTTCAGCATCTCTGTTTACACTTACACACTCATTTTATCAATGCACCGTATATCTGATGTTTGTGTTTGAGGATTAATGTTCAGTCGCAGGCCGTGACCAAACGTTCATCTCAGAGACGTTTCTGTTCAGTATGATCAAGTGGCACATTTGCACTGTTATTCATTGGTTTTACTCTGTGTGTTTTCCAAATAACAGCCCTGTAAATGTGGAAAACATACTGAACGAGTAGTTATAAGTGTAATGTGCTCTTGAACGATCTTGCTAGTGCTTTGAATCAACTTTGTGCACAGTATCAGGATTCGCAAATGAATGATTCTGAGTCTGCATAGTTATTTGATTCACTTAAGATTCAGTTTGTGATTCTTTTGAGTCTTTTGAATCATTTTCCCGTGGGTCATTATTCATGCTGTCAACAATTTGTATGTCATTTATTTGTTTTGATTCAATAAATCAAGTGGTTCATTCAATCATATTTAAATTATAAACCTAAATAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38416
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067414 Nonsense 513 1136 13 30
ENSDART00000112210 Nonsense 704 1237 12 26
ENSDART00000127894 Nonsense 633 1166 10 24
ENSDART00000135701 None None 84 None 5
ENSDART00000141952 Nonsense 515 1138 10 27
Genomic Location (Zv9):
Chromosome 4 (position 2851037)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3049916
GRCz11 4 2980027
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCAGCTCTCCTGACTGCTGTGCTTTCCTCTTTCTCTGTCAGTACTCCTA[T/A]CCTGCGGAACGCAGAGCTGCTCCTCCCGCACAGAACATCACTGCACAGTC
Long Flanking Sequence:
ATGGATGGGAGGATAGAAAGAGTTATGGATGGATGGATGGATGGATGGATGGATGGATGGATGGATTAAGAGAGAGCGATGATGGATAGAGCGATGCATGGATGGATGATAGATGGATGAAGAGCGTGATGGATTGATGGAGAGAGGTATGGATGGATGGATGGATGGAAAGATAGAAAGATAATTTCAGCCTCTGTAAGCAGAAGTGACTTCTTTCAAAGACAGTAATACAATCGTAAGATGGAAGAGCATTGGCAATACTGTATAGCGTTGGTCAAGTCATACTCATCTGTCTTCACATCTGAATCCTGCTCAAAGACGTTCATCAATGAATATGCAGTAAACCAGTCGTTTTTAAGAGCTGATAATGTTATTTTTGCTTTAAATGACTGAGCCTTTAAGAGTTTCTAATTCTCAGCGTTTAATGCAGTTTTGAGCAGAACTCTTTGTTGCAGCTCTCCTGACTGCTGTGCTTTCCTCTTTCTCTGTCAGTACTCCTA[T/A]CCTGCGGAACGCAGAGCTGCTCCTCCCGCACAGAACATCACTGCACAGTCTCTTCAAGGCAAAACGGTACGTGCTCCCACTTCTCCACCCACCACTTCCTCTGTGCAAAGGAAACGCTTGTAACTCTCAGAGCCAAAACTTTGCTTTCCTGTCAAACTCTTTGCATTTTTTTTCAGTTTCCAGCCACTAAGGATTCGTTCGGGCTTTGGTTTGCAAATTAGGCTTTTTCGGAGTGAATATTTCACATGCGGAGGTTGAGTCAACATGAATTGTTGCTTTCTTGAAGTGCCCCTGTTATGCTTTTTCAGATACTACCTTTCGGTTTTGTAGCTGTTTGTGGATGCAAAAGATCTGAAAAGTTTCAACGATCACATTAAATAGTTTCACACAGTTCTGCACAAGCCTATTGTTGTTTCTAATATATTTGCATAATGTTATTCTGTAGTGCTTATTGGCTGCCTAGGAATAACAAGTATAGAGCAGAATAGTGCCATCTGACA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5241
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067414 Nonsense 618 1136 16 30
ENSDART00000112210 None None 1237 None 26
ENSDART00000127894 None None 1166 None 24
ENSDART00000135701 None None 84 None 5
ENSDART00000141952 Nonsense 620 1138 13 27
Genomic Location (Zv9):
Chromosome 4 (position 2841847)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3040726
GRCz11 4 2970837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCATGATTCACACTATGATTGAGAACTCGGCGCCCCGGCCGCAGCTCTA[C/A]CAGCAAGTAAGGTCATGTGACACACGGTTATGCTCCTCCCCTCTCCGTGT
Long Flanking Sequence:
TCTATCTATCTATCTATCTATCTATCTATCTATCATCTATCTATCTATCTATCTATCTATCTATATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTACTAGTGATATTTTGCATATATCTCGTATGTAATGCTGGACATTTGGATGTTTTCAAGATGGATTTCTGCTTTCCATTAATTAATCTCTTTTAAAAGTTAGTCTGAAGACACGTCGTCGCTCTTTGCCAAAGCCGCTGATATTTTTTTTACATCGAACTGCAAAACTCCAGTGCAGCGTCATGATTGTGCACCAGAAAGCCGTGTGTTTGTGCGGTTCAGAAGCTGTAAAACATCAGCGTGTGTCTTGCAGTGCTTTGATAACGGCTGTTCCTCCTCCTCCTCCTCCTCGCGCACTAGATGAAGGAGAACGAACCCATAATCTTCATGATTCACACTATGATTGAGAACTCGGCGCCCCGGCCGCAGCTCTA[C/A]CAGCAAGTAAGGTCATGTGACACACGGTTATGCTCCTCCCCTCTCCGTGTCATGGCCCTGCCTCTTTGTTGAAGCTCCACCCCCTCTTCACCGCCCCATTCTGTGTCGGTTTGGTTCCAGCACATCCCATTGGTTGTTGTTGATGTTGTTGTTGTTGTTTTCTTGTTGATGGTTAAACTGGTGTTAGCATGGCTTTCGGAGCAGCTGCTGGTGCTAATGTGACGCTCATTAGCAATGGCTTCATCCATCATGCTAGCTTTCATGACTTAGCCCAGTCCCTTTTGCCTCATAAACAAGACTTTATGAGGTTTAAAAGGACATAACGGACTTGAAGAATGAAATGATGTTGAGTATGAATACGAAATAAAGGATGATCATGATAATTAAGCCAATGATTTTCAGAATTAACGGTTTAATGACTGACAAAGTATTGATCTTGGTGGTTGATTGCTCTGGTCTGAATGAGATTTAGCACACCATAAGATAGTGATCTTGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40204
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067414 Essential Splice Site 669 1136 19 30
ENSDART00000112210 Essential Splice Site 776 1237 15 26
ENSDART00000127894 Essential Splice Site 705 1166 13 24
ENSDART00000135701 None None 84 None 5
ENSDART00000141952 Essential Splice Site 671 1138 16 27
Genomic Location (Zv9):
Chromosome 4 (position 2835748)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3034627
GRCz11 4 2964738
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATTAAAACAGCTTGTGTCTCACTCCTGCATGCTTGTGTGCTTGTTTTT[A/C]GCACACACTGGAGACGGCGCTGCTCTCCGCCAGTCAGGAGATCGAGATGA
Long Flanking Sequence:
TTTTATGAATTCACAAGCATTTTCAGACTACCTGAGATATTATTACATAAAGAATAAAGTTGCTTAATAAAACATCCTCGGCTTTATTGTCTGCAGGCGAAGTTAAGTCGGCTCTGTGAGCAGGACAAAGTAGTGCGAACTCAAGAAGAGAAACTGCAGCAGCTCCACAGAGAAAAGGTGAAGTCCATCAGCAAGTTCAGCATCTTTAGCTGTGTTTCCATCCAAAAATATGAATTAGAAAAAATATAAAGATATAAATCACATGACTTTACTGATGCTCATGCTGGAGTTTATTCAGTAAATGTGTTTCCCTCTTAGTTTATGTCCATTTTTACTTATCTAATTAATATTTATTCATTATTAATGCACATTTTCAAAATCTATGCTTATTTTGTTGCTTTCATTAAGCACTTTTATGCGATATTGTAATAAATGCACATTAGAATAGCTGGATTAAAACAGCTTGTGTCTCACTCCTGCATGCTTGTGTGCTTGTTTTT[A/C]GCACACACTGGAGACGGCGCTGCTCTCCGCCAGTCAGGAGATCGAGATGAGCTCTGAAAACCCAGCGGCGGTCCAGAGCGTGGTCCAGCAGAGGGACGTCCTGCAGAGTGGCCTGCTGAGCACCTGCAGAGAGCTGAGCCGCGTCAGCACTGTACGACAACACACACTCACAATACATTCAACAGAGCAGAGCAATTCCGTGCAAATTTCAACCTTGCCATGAAAAAAAAATTATGTTTTCACCAAAATATTGAAAGCCTTTTTAGGTTTTTTGTGTAAGCAAGTATTTTACAGTAGTGTAAATATACTCATAAATGTCTGTCAGTGTTCTCAAACTATTATATTTAATTTACCAAAGTCACATAAGTGCCAATTTCACATCTGCCACATCCATAACAGAGAGATGTCACATCCATAATGCAAAATCTAATCAAATCAATGATGTTTGCTCTATAGAGAGCAGCTCTTCTCCTTTTGATGATCCATATTTCTTTTGTGTC
Associated Phenotype:
Not determined