Busch Lab

ZMP

si:ch211-214j24.7

Ensembl ID:
ENSDARG00000045850
ZFIN ID:
ZDB-GENE-041210-79
Description:
Transmembrane and coiled-coil domain-containing protein C6orf129 homolog [Source:UniProtKB/Swiss-Pro
Human Orthologue:
C6orf129
Human Description:
chromosome 6 open reading frame 129 [Source:HGNC Symbol;Acc:21239]
Mouse Orthologue:
1110021J02Rik
Mouse Description:
RIKEN cDNA 1110021J02 gene Gene [Source:MGI Symbol;Acc:MGI:1915847]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26209
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067380 Essential Splice Site 18 100 2 5
ENSDART00000137966 Essential Splice Site 18 100 2 4
ENSDART00000144658 Essential Splice Site 18 82 2 4
Genomic Location (Zv9):
Chromosome 4 (position 5128664)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5246845
GRCz11 4 5255415
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATATTGTAATATAATAATATTAACGTCTTAATTTACAATGTTTTTAAA[G/T]ATTGACCGCGTAGAAGAGCGTAAATTGCAGTGTAAAAACAGCCTGGAGCG
Associated Phenotype:
Not determined