Busch Lab

ZMP

si:dkey-14d8.7

Ensembl ID:
ENSDARG00000045834
ZFIN ID:
ZDB-GENE-041210-143
Description:
hypothetical protein LOC557676 [Source:RefSeq peptide;Acc:NP_001038301]
Human Orthologue:
DPT
Human Description:
dermatopontin [Source:HGNC Symbol;Acc:3011]
Mouse Orthologue:
Dpt
Mouse Description:
dermatopontin Gene [Source:MGI Symbol;Acc:MGI:1928392]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa2154 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2154
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008692 Essential Splice Site 18 173 1 5
ENSDART00000132837 None None 119 None 3
Genomic Location (Zv9):
Chromosome 4 (position 5410435)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5528616
GRCz11 4 5537186
KASP Assay ID:
554-2712.1 (used for ordering genotyping assays)
KASP Sequence:
GAGAGCTGCTGTATTTCTGCTGCTGACCRCTCTCTTGGCGAGTGGACAGG[G/A]TGAGAAGCTTTTTGAACGTTTTTTCACTTCTTATAAATCAATATATAGGC
Associated Phenotype:
Not determined