Busch Lab

ZMP

zgc:101783

Ensembl ID:
ENSDARG00000045824
ZFIN ID:
ZDB-GENE-040912-48
Description:
hypothetical protein LOC447883 [Source:RefSeq peptide;Acc:NP_001004622]
Human Orthologue:
FAM3C
Human Description:
family with sequence similarity 3, member C [Source:HGNC Symbol;Acc:18664]
Mouse Orthologue:
Fam3c
Mouse Description:
family with sequence similarity 3, member C Gene [Source:MGI Symbol;Acc:MGI:107892]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa10699 Essential Splice Site Available for shipment Available now
sa44286 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa38061 Nonsense Mutation detected in F1 DNA Not yet available
sa44287 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10699
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067354 Essential Splice Site 42 241 3 9
ENSDART00000138851 Essential Splice Site 42 192 4 9
ENSDART00000138946 Essential Splice Site 42 79 4 5
ENSDART00000145334 Essential Splice Site 55 183 5 9

The following transcripts of ENSDARG00000045824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 20226811)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19638788
GRCz11 25 19736739
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TYCTACTGATGCATGCRATGTATGGTATATATATATTTGTGTAAAACACA[G/C]AAAGGTCAGTGGATGAAATGCATTTAGTCCCGTCGAAACCTGATGTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44286
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067354 Splice Site, Nonsense 107 241 5 9
ENSDART00000138851 Splice Site, Nonsense 107 192 6 9
ENSDART00000138946 None None 79 None 5
ENSDART00000145334 Splice Site, Nonsense 120 183 7 9

The following transcripts of ENSDARG00000045824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 20227325)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19639302
GRCz11 25 19737253
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTAAATCACAAGTGGAGTTTAAGCCAGTTCTGCAATTTTGTTTAAGGT[T/A]AATACAGAAAGAGACACGAGGTAACTGGCTTGGAATTAATATTGCTGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38061
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067354 Nonsense 140 241 6 9
ENSDART00000138851 Nonsense 140 192 7 9
ENSDART00000138946 None None 79 None 5
ENSDART00000145334 Nonsense 153 183 8 9

The following transcripts of ENSDARG00000045824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 20228707)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19640684
GRCz11 25 19738635
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATTCAGAAGAAACGGGTGAGCACGTCAAAACTGGCAGCTTCAATATGTG[G/A]ACTGGAAGTATGTTTCATCTTCATGTTACTGATCTAATTTCTTACCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44287
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067354 Nonsense 142 241 6 9
ENSDART00000138851 Nonsense 142 192 7 9
ENSDART00000138946 None None 79 None 5
ENSDART00000145334 Nonsense 155 183 8 9

The following transcripts of ENSDARG00000045824 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 20228711)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19640688
GRCz11 25 19738639
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAAGAAACGGGTGAGCACGTCAAAACTGGCAGCTTCAATATGTGGACT[G/T]GAAGTATGTTTCATCTTCATGTTACTGATCTAATTTCTTACCTTGTAAAT
Associated Phenotype:
Not determined