Busch Lab

ZMP

abhd2b

Ensembl ID:
ENSDARG00000045804
ZFIN ID:
ZDB-GENE-061027-74
Description:
Abhydrolase domain-containing protein 2-B [Source:UniProtKB/Swiss-Prot;Acc:Q05AK6]
Human Orthologue:
ABHD2
Human Description:
abhydrolase domain containing 2 [Source:HGNC Symbol;Acc:18717]
Mouse Orthologue:
Abhd2
Mouse Description:
abhydrolase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1914344]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24656 Essential Splice Site Available for shipment Available now
sa25225 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44278 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24656
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067327 Essential Splice Site 130 422 4 11
ENSDART00000127577 Essential Splice Site 130 422 3 10
Genomic Location (Zv9):
Chromosome 25 (position 19623149)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19035126
GRCz11 25 19133077
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGCTACCTTTGACCTGTTTGAGCCGCAGGGGGTCCACAGCACTGGAGG[T/C]GAGCTTGGGTTCACTGAAACAAAATGTATTTTTACGCAACAAAATTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25225
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067327 Essential Splice Site 312 422 8 11
ENSDART00000127577 Essential Splice Site 312 422 7 10
Genomic Location (Zv9):
Chromosome 25 (position 19617707)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19029684
GRCz11 25 19127635
KASP Assay ID:
554-7711.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTCTATACAGCCACCTCTCTCATGCAGATTGATGACAACATTATGAGG[T/A]TCTGGAAAAACCTTCATCGCACTATTTTGCTTTTAGATGTCAGATAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44278
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067327 Essential Splice Site 336 422 10 11
ENSDART00000127577 Essential Splice Site 336 422 9 10
Genomic Location (Zv9):
Chromosome 25 (position 19615308)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19027285
GRCz11 25 19125236
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGCATAATTGATATATTTTATGGTAACACTAATATTTGTCATTTATTTC[A/T]GATCAGCGTTCCTCTCCTCTTGGTGAACTCTTCAGATGATCCATTAGTCC
Associated Phenotype:
Not determined