Busch Lab

ZMP

si:dkey-108d22.2

Ensembl ID:
ENSDARG00000045765
ZFIN ID:
ZDB-GENE-041210-88
Description:
hypothetical protein LOC563551 [Source:RefSeq peptide;Acc:NP_001119582]
Human Orthologue:
ASB13
Human Description:
ankyrin repeat and SOCS box-containing 13 [Source:HGNC Symbol;Acc:19765]
Mouse Orthologue:
Asb13
Mouse Description:
ankyrin repeat and SOCS box-containing 13 Gene [Source:MGI Symbol;Acc:MGI:2145525]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa33414 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8158
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102341 Nonsense 28 280 2 6
ENSDART00000140954 Nonsense 28 280 2 7
Genomic Location (Zv9):
Chromosome 4 (position 10549327)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11485954
GRCz11 4 11484803
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTTTTAGGTTTCTGGGCCGAGAGAACGGAGGTTCACAAGGCTGCGTA[T/A]GAGGGTGAGGTGTCGGTGCTGCAGGATTTGATTTCGAGCGGAGCATCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33414
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102341 None None 280 None 6
ENSDART00000140954 Essential Splice Site None 280 6 7
Genomic Location (Zv9):
Chromosome 4 (position 10554372)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 11490999
GRCz11 4 11489848
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATTCCCAACCGTATTATCAGTTACCTCTTATACCGATGAAGCTCAAGG[T/G]GTGCAGACACTGTGGAAAACTTTTTTTTTTTTTACCTCAAATGCACAAAA
Associated Phenotype:
Not determined