Busch Lab

ZMP

si:ch211-152m4.1

Ensembl ID:
ENSDARG00000045747
ZFIN ID:
ZDB-GENE-041210-247
Description:
wingless-type MMTV integration site family, member 16 (wnt16), mRNA [Source:RefSeq DNA;Acc:NM_001100
Human Orthologue:
C7orf58
Human Description:
chromosome 7 open reading frame 58 [Source:HGNC Symbol;Acc:26159]
Mouse Orthologue:
A430107O13Rik
Mouse Description:
RIKEN cDNA A430107O13 gene Gene [Source:MGI Symbol;Acc:MGI:2444814]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa38426 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20221 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38426
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067251 Essential Splice Site 234 975 5 24
ENSDART00000143690 Essential Splice Site 89 839 3 19
Genomic Location (Zv9):
Chromosome 4 (position 9711226)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10647853
GRCz11 4 10646702
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTTTTCCACATCTCCACTAGAGGGAATCCAAAATACTAATGATGCATGG[T/A]GAGTTATGTCAAGTATAAAAAAAATGGTCTACCAAAAATGTTGTAAAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20221
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067251 Nonsense 654 975 15 24
ENSDART00000143690 Nonsense 496 839 13 19
Genomic Location (Zv9):
Chromosome 4 (position 9752279)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10688906
GRCz11 4 10687755
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTTTGGAGCCCATTCCAGGAGTGAGATCTTCAGGAGAGGCCCAGGCTT[C/A]ACTTCGGCCTTGCCTCTCAGGAGATGAACCTGGTATGTTTGCTTCAGGTT
Associated Phenotype:
Not determined