Busch Lab

ZMP

prickle1b

Ensembl ID:
ENSDARG00000045694
ZFIN ID:
ZDB-GENE-030131-2152
Description:
prickle-like protein 1 [Source:RefSeq peptide;Acc:NP_001025269]
Human Orthologue:
PRICKLE1
Human Description:
prickle homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17019]
Mouse Orthologue:
Prickle1
Mouse Description:
prickle homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1916034]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa40255 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40255
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067177 Nonsense 48 872 2 8
ENSDART00000144127 Nonsense 39 256 2 6
ENSDART00000147955 Nonsense 39 863 2 8
Genomic Location (Zv9):
Chromosome 4 (position 13034472)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13971099
GRCz11 4 13969948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGCCAAGGCATTTGGGTTTCAGAGGAGTTCAACGTCTGATGACGACTCT[G/T]GATGTGCTCTTGAGGAGTACACATGGGTTCCTCCTGGACTACGGGCTGAG
Associated Phenotype:
Not determined