Busch Lab

ZMP

tnpo3

Ensembl ID:
ENSDARG00000045680
ZFIN ID:
ZDB-GENE-040426-708
Description:
transportin-3 [Source:RefSeq peptide;Acc:NP_957381]
Human Orthologue:
TNPO3
Human Description:
transportin 3 [Source:HGNC Symbol;Acc:17103]
Mouse Orthologue:
Tnpo3
Mouse Description:
transportin 3 Gene [Source:MGI Symbol;Acc:MGI:1196412]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa20237 Nonsense Available for shipment Available now
sa8594 Nonsense Mutation detected in F1 DNA Not yet available
sa13543 Nonsense Available for shipment Available now
sa44585 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2179
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067161 Essential Splice Site 40 923 1 23
ENSDART00000138201 Essential Splice Site 40 922 1 23

The following transcripts of ENSDARG00000045680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 12651497)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13588124
GRCz11 4 13586973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCCGGCAAGGAGCGCGCCTCGGTCTGGCTAGGAGAGCTGCAGAGATCGG[T/A]GCGTTTATGAGCGGGCCTACTGCGCCATAACACTATCACTCATTTAGAAA
Long Flanking Sequence:
GGAATGACCCTCAGTGGGTGTGTCTCCAACGAAATTATTCCCAAAAATATATACCTCGCATTACACTGAACTCACAAACCGCAAAACACATTTAACTCTTAGAAAGTTATTTTTTAAATGTTGACATATTTCTGCGAGTTGTCCGAATGTCGCGCTATTAACATAAAACCGCTGTGGTCCGGACTCATTATAGTTCCCGTGCCGTAGTTTCCACACGGACTTGTTTGACAGGAACGCCCTGTGTCTTGCTTGAGATGGCGGCCAGATCGGAGAACGCGAGGGCCGAATAAATAGTCAACCTGCGCGTCAGTAACCTCCCGAGAAGCGCAAGCAGTGTCATTTACCCCATATCTACACCCTCTAGAAGCAGAAGAGCACCATGGAAGGCGGGAAACCCACCCTGCCGCTGGTTTACCAGGCCGTGCAGGCGCTGTATCACGACCCGGACCCTGCCGGCAAGGAGCGCGCCTCGGTCTGGCTAGGAGAGCTGCAGAGATCGG[T/A]GCGTTTATGAGCGGGCCTACTGCGCCATAACACTATCACTCATTTAGAAACGTTTAAAAATATCAATGTATTAAAGGAAAAGTCAGATAAGGCCGCTGTGACGCTATTTAAACCATCAACAGCAGCTGGGTTGAGAAGTGGAAGTGGTCACATGTGTTTGGACTGTTGTGGAGGTTTATTTGTATCCATTGCTAAATCCTTCCAGCTTGTATAAGATTTGATGGCTTTATTATTGCGTTATTTGCTGGATTTAAGCAGCAATTTGAGCGGAAATACTCCGTGTAAACATGACTATAATACAGACTTCCCTGTTAGCAAGCTGGTGTGTTTTGAAACATGGCAGCTAGTTTGTAACGTTAGCTAAGCATTAGCTAGTTGACCATGTTTCAGAAACCAGCTTGACTACCTTGTTAACTGCTTTGACTAACTAGTAGTTGGGATTTTTTTAGTGCAATATGGTTTTATCTCCAAGGCCAGATGGAAACAAGCTATCATGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20237
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067161 Nonsense 44 923 2 23
ENSDART00000138201 Nonsense 44 922 2 23

The following transcripts of ENSDARG00000045680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 12654158)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13590785
GRCz11 4 13589634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGACAAATGTTTCCTTTTTTTTTAAAAAATCTATCCAGATGTACGCGTG[G/A]GAAATCTCCGATCAGCTCCTGCAGCTGAAACAGGACATCGAGTCTTGTTA
Long Flanking Sequence:
TTTTTCAGGACTGTTTAATATTTGCATTATCTTCAAATTGAGATACTCGTCAAGTCATACTTTCTGTTTTAGAAAATATATATTGGCTGAATGGTTTCAAAGTATTACTTCACATTCTCTAGCTCATCTCATTTCTCATATATATGATGAGCATTCTATCCCTTTAGACTTCAATGATATGTTACACACAACATGTTCCTTCTATCTATTTGCATGTATAATATTTATCCTGGTGTGACGCATCTCATGGTGTAGTGTTTATTTTTACCTTTGATTATGCAAATTAGCTCTGGGCCAAGTTGATATTCAGTGTCTGATAGAGTGATAGCTAGTGAAATAATGCCCATTTCTTTTGATTAAATTAAATAAGCCCTTTAGGGTAAATAAACAAACACTTTAAATGTCATTGAGCCATTTTGAAATATTTAAAAAATTCTGCTTTACAAAGTGGTGACAAATGTTTCCTTTTTTTTTAAAAAATCTATCCAGATGTACGCGTG[G/A]GAAATCTCCGATCAGCTCCTGCAGCTGAAACAGGACATCGAGTCTTGTTACTTCGCAGCCCAGACGATGAAGATGAAGATCCAGACGTCGTTCTACGAGCTTCCCCCAGATTCTCACACTGCACTGAGAGATTCACTCTTATCTCACATCCAGAACCTCAAAGACCTTTCTCCCATCATCGTCACACAGGTACGTCCTACCTACTTTTGAAAATCTGTGCCAGTCATGATCGGAAATTATCGGACATGCAGTGTGGGGGGTTGACGGGGACAGTCCATCTCCACCACACACTGCACTGCTACATATTGAGAACTGTTAAGAATGTGGCGCTGGTATTCTAATGTGGTTCTCTCTCTCTCTCTCTCACCCAGCTCGCATTGGCAATCGCAGATCTGGCTCTTCAGATGGCCTCGTGGAAAGGCTGCGTTCACACCCTCATAGAAAAGTAAGAATCCTCCTTATTTTCTCCCTGGTTATGACCTACAATGGTGTTATGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8594
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067161 Nonsense 203 923 5 23
ENSDART00000138201 Nonsense 203 922 5 23

The following transcripts of ENSDARG00000045680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 12656091)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13592718
GRCz11 4 13591567
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGTGTGCGGAGAAGTCTGGCCACGACGAGAAGATGCTCATCAAGGTGTWC[C/T]GATGTTTGGGGAGCTGGTTTAATTTAGGAGTGCTGGACAACAATTTCATG
Long Flanking Sequence:
TAATTTGCAAGGACTATTAATATGTAACTTTTTTTTTTAATTGGTAAATGTATTTTTTATAGCAGTATTTTGTGTGAAAATATGTATGTAGTCTTTTTGTTTTCGTTTATGTACTTTGGGACAAGCGTTTTAATTATATTTGCGGTATATTAATCTGCATTTTAGTGTTCTGCCAAGTCAAGTTATAACTTACACCTTGAAAACTATCACTGGACAGTTTTTAAATTTGGACATCTTTGTTAACCGAGGCATAGTTTTTATGATGGTTCATATCTCTGTGTGTGTCCTCATCAGTTGTTGCTGTTATTTTGCTTGCACTTCTCCTCTGTTCTATTCTCTCATTCTCTTCATGCAAATCATATCTGCGGTTATATGGTGTATGAACATTCATTTAAATGAGTTGACTGTGATCTGACTGTGGGTATTTCACTTATCTCTGTGATCAGGTGACGTGTGCGGAGAAGTCTGGCCACGACGAGAAGATGCTCATCAAGGTGTTC[C/T]GATGTTTGGGGAGCTGGTTTAATTTAGGAGTGCTGGACAACAATTTCATGGCAAACAATCAACTGCTGATGATTCTCTTCCAAGTGCTGGTAAGATGGAGTCAGATAGTCACTTTATTTTCCCACTTTTTCTTACTTTTATTTTAAAAATGTTTTTTCCCCACTCGTCATTGAAGCAGAGGGATGAGACGTCTACAAACCTGCATGAGGCAGCATCAGACTGCGTATGCTCAGCATTGTATGCAATCGAGAATGTGGCCATTCACCTGCCGCTGGCCATGCAGCTCTTCCAGGGAGTCCTTACTTTAGAAACAGCCTACCACATGGCCGTGGCCCGAGAAGACCTCGACAAGTATGTATGGCTCTGCTTGTGAATAATATAAAGGGTTCATCGAATTTCTGTAATATTCTGGAAAAGGTATATTCCAGACGTTGGAAGTCAGGGAATTTTTAGGTATTTTATTTATAATTTATTTTAGTCATGGAATATCGGGAGTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13543
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067161 Nonsense 530 923 12 23
ENSDART00000138201 Nonsense 529 922 12 23

The following transcripts of ENSDARG00000045680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 12660347)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13596974
GRCz11 4 13595823
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCGTTGGCCTCTGCRGCAGCTAAAGCCATCCATAACATCTGCTCGGTGTG[T/A]CGAGACCACATGGCGCAGCACTTCCAGGGCCTGCTGGACATCGCCCGCTC
Long Flanking Sequence:
TTATTTGTATTATCAAAGAAAAAGGATTTTCATACAAAGTTGTAAATTTGATCTGGATTTGTCATGAAATAGCCAGAGAAGCTGATAGCTATCTCTCTATCTTCCTCTCTCTGCATGTAAACAAACCTAAATCTCCAGTTTGTTGACGTATAAACATTAAATTGAGCATTTATCAAACATCATTTTGAGATGATAATCTCAAAATCATTTTGAGAGATAATCGTATTGTGATGATTAGCCTCATCTACAGTAGTCAACATCCAAAGTGAGTCAAAAATGTTTTTCAAAATTGTCCTAGGTCAAGAATGGGTGTTGTTTAATAGTTTAAGAACAACTTTCATCAAATGTGATGATTTACTTCAAATGTTGATTACTATATATACTCATAATGTCTGTTTTGGGTTTGCAGATACTGTTTTGAACTTCCTGATGAAGGGTTTACGGGAAAAGCCGTTGGCCTCTGCGGCAGCTAAAGCCATCCATAACATCTGCTCGGTGTG[T/A]CGAGACCACATGGCGCAGCACTTCCAGGGCCTGCTGGACATCGCCCGCTCTCTCGACTCATTTGCCCTGTCAACAGACGCCGCCGTTGGCTTGCTCAAAGGTATCAGGAAAGGGTCTTTAAAAAGTTACTTTTCCCCTTCACTATTCTGCGGTTTGCAGAAGGTACACACTTCTCCTCTAGCGCTTGACCCTTTTCTGTTGTTCTTAGTCATGCCCTTGTTGTATGGCTGGTTTGGTTTAAGAGGTGTGATTGGTTTACTTAGGTACAGCGCTGGTTTTGGCCCGTCTCCCGCTGGAGAAGATTGCGGAGTGTCTGAACGATCTGTGCGCAGTTCAAGTCATGGCACTTAAGAAGGTTAGATATATGCTGTCTGTGGACTGTATGACTCTCTGGGTGTTTAATGCTGGAAAATAATGTGTTGTTTTGGTGTGCAGCTGCTGGCTCAGGACTCCAGTAGTGGGAAGTCGTCAGACCCTACTGTATGGCTGGACAGACTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44585
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067161 Essential Splice Site 904 923 22 23
ENSDART00000138201 Essential Splice Site 903 922 22 23

The following transcripts of ENSDARG00000045680 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 12666624)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 13603251
GRCz11 4 13602100
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTGAAATGTGATGATAATTTTCTGCCTTTCTGTAAATCTGTCACCATA[G/A]TGCAGAGGAATGTAAACAGGTTTGTTGGGCCATAAGAGAGTTTACCAGGC
Long Flanking Sequence:
TGCCGTCACAATGACTCTTCAAAGCACACCAGACGCATTAGGATGCATTCATCGCAATTACATTACACTCCCAAACAAAATGGCCATGATTAAAAGAGCTGTTGTCCACAATTAAAAGTAATACGGGACTCATCAGTGTAGATTACAGGCAGCATTTGTATCTTGGCCTATTGCAAGTTAGTGCACGTTCAGATTACTCTGTGGTTTACTCTACACAACAAGCCTAAACAAGCACCAATAACCAGTCGTCCAGGAGGGTGAAGTATGTCGTTCCTCTGCAAGTCTTGACCTGAGATGCCAAATACAAACTCTTATAGTGAGTGCAGGATGAGTCATAGACTTGCGTGGAAAGTCCAACCCACGCCAAAATGACTGATTTATTGCTCGCGCATGCTTATGGCGTGCTCGCGAGTTGATTTTAAAATAGCAGGCCATCTTGTTGTTTAGTTCTGTTGAAATGTGATGATAATTTTCTGCCTTTCTGTAAATCTGTCACCATA[G/A]TGCAGAGGAATGTAAACAGGTTTGTTGGGCCATAAGAGAGTTTACCAGGCTGTACCGATAGCTGTCTTCTACCTGCTGATGCTGCAAGACCAGGTGAGAGAGAGAGAGGAAAATGAAACAATTTGTCAGTGTATTGTGCATAACATTGAATGTGTCTTTTCTATGTTTATTCAAATTAGGGCTGCACAATATACTGTTTCGGCATTGACATCGCAATATGTGCATCACCAATCGCGAGATACTCGATGAGTCTGAATAATGTTCACCAGGAGCTTCAGAATTGATTTAATTACTGCATTTATATAGAAATGTATACGATTTATCCCCCCCCAAAAAGTTTTTCTTTATTTTTCAATATTTTTCTAGTCCAAATATTCACATTTTAGAGCAAAAACAAGATTATTTGACTTAATTTAGCTTGTTTTAAGGAAAAACTCTTAATTTTGCCTAATTTCCAAAGTTGAAAACAAAACTATTTGACTTGATCTAAGAATTTTTAG
Associated Phenotype:
Not determined