Busch Lab

ZMP

FAT4

Ensembl ID:
ENSDARG00000045665
Description:
FAT tumor suppressor homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:23109]
Human Orthologue:
FAT4
Human Description:
FAT tumor suppressor homolog 4 (Drosophila) [Source:HGNC Symbol;Acc:23109]
Mouse Orthologue:
Fat4
Mouse Description:
FAT tumor suppressor homolog 4 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:3045256]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa6331 Nonsense Mutation detected in F1 DNA Not yet available
sa1616 Nonsense Available for shipment Available now
sa14018 Nonsense Available for shipment Available now
sa10891 Nonsense Available for shipment Available now
sa45505 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10334 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6331
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067146 Nonsense 210 2485 1 24
ENSDART00000122984 Nonsense 212 2702 1 22
ENSDART00000131031 None None 2346 None 10
Genomic Location (Zv9):
Chromosome 14 (position 455954)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 424447
GRCz11 14 447340
KASP Assay ID:
554-4456.1 (used for ordering genotyping assays)
KASP Sequence:
CAGATTGCAGCCAGTGATCTGGATGAAGGTGCAAACGCTGAWATAACCTA[T/A]CTTTTAGATGAGGGGACYCCTTTTCAGATTGACCCCAAGGCTGGGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1616
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067146 Nonsense 712 2485 3 24
ENSDART00000122984 Nonsense 929 2702 1 22
ENSDART00000131031 Nonsense 492 2346 2 10
Genomic Location (Zv9):
Chromosome 14 (position 453805)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 422298
GRCz11 14 445191
KASP Assay ID:
554-1557.1 (used for ordering genotyping assays)
KASP Sequence:
ACCAGCTCTCRTATGAGGTCACCATTCTCGAATCAGAACCCGTCAATAGT[C/T]GATTTTTCAGAGTTGAGGCTACTGATAAAGACTCTGGCGTCAATGGGGAA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14018
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067146 Nonsense 818 2485 4 24
ENSDART00000122984 Nonsense 1035 2702 2 22
ENSDART00000131031 Nonsense 706 2346 2 10
Genomic Location (Zv9):
Chromosome 14 (position 453163)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 421656
GRCz11 14 444549
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTAARGACATTTACCAGGCCTCGATYGCAGAATCCGCCCAGAACATGACA[C/T]AGCTGCTCCGAGTGTCCGCCTCAGATGTGGACGAAAACAAAAACGGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10891
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067146 Nonsense 874 2485 4 24
ENSDART00000122984 Nonsense 1091 2702 2 22
ENSDART00000131031 Nonsense 762 2346 2 10
Genomic Location (Zv9):
Chromosome 14 (position 452995)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 421488
GRCz11 14 444381
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTACTCTAGTGGGGAAACTAGACTACGAAACAACACCCTYTTACTCCCTC[A/T]AAATCATCGCAGAGGATTCTGGGAGCGTCCCTCTGTCTTCAACCTGCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45505
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067146 Essential Splice Site 1700 2485 16 24
ENSDART00000122984 Essential Splice Site 1917 2702 14 22
ENSDART00000131031 None None 2346 None 10
Genomic Location (Zv9):
Chromosome 14 (position 401926)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 378910
GRCz11 14 389496
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCCACACAGAAACACCAACTGACCCAGCTGGGAAAATAATAAGTTATGC[A/G]GTGTTTTAGATGTGGTAAAGTCGATATAGATATGCAGTATTTTTATTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10334
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067146 Essential Splice Site 2477 2485 24 24
ENSDART00000122984 Essential Splice Site 2694 2702 22 22
ENSDART00000131031 None None 2346 None 10
Genomic Location (Zv9):
Chromosome 14 (position 389605)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 366589
GRCz11 14 377172
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACTTCCTTTCCAATYACTACCTCAGTTTCTTGCGCATCGCCAATTCACA[G/A]TTAGCCGGTCTAGGCACTGGAGTCCAGATCTATGGGGTGTTTGAACTTAA
Associated Phenotype:
Not determined