Busch Lab

ZMP

hic1l

Ensembl ID:
ENSDARG00000045660
ZFIN ID:
ZDB-GENE-030620-1
Description:
hypermethylated in cancer 1 like [Source:RefSeq peptide;Acc:NP_571558]
Human Orthologue:
HIC2
Human Description:
hypermethylated in cancer 2 [Source:HGNC Symbol;Acc:18595]
Mouse Orthologue:
Hic2
Mouse Description:
hypermethylated in cancer 2 Gene [Source:MGI Symbol;Acc:MGI:1929869]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32536 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32536
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067138 Nonsense 221 454 2 2
Genomic Location (Zv9):
Chromosome 25 (position 26431121)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 25470603
GRCz11 25 25565681
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAAGGGGGTGTGTTTCCCAAAGGAGGAGAAATTGATAAAACCTTTGGAT[G/T]GAGCTCAGGAAAGAAAAAGAGAAAGATCCCAAAGAAAATCCAATTTCAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4313
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067138 Nonsense 440 454 2 2
Genomic Location (Zv9):
Chromosome 25 (position 26430464)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 25469946
GRCz11 25 25565024
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CAGGAGAGAAACCGTATGCCTGCCAGGTTTGTGGAGGGAAATTTACACAA[C/T]AAAGAAACCTCATTAGTCATATGCGGATGCATACCTCAGCATCTTAAAAC
Associated Phenotype:
Not determined