Busch Lab

ZMP

fbxl22

Ensembl ID:
ENSDARG00000045641
ZFIN ID:
ZDB-GENE-050227-1
Description:
F-box/LRR-repeat protein 22 [Source:RefSeq peptide;Acc:NP_001013297]
Human Orthologue:
USP3
Human Description:
ubiquitin specific peptidase 3 [Source:HGNC Symbol;Acc:12626]
Mouse Orthologue:
Usp3
Mouse Description:
ubiquitin specific peptidase 3 Gene [Source:MGI Symbol;Acc:MGI:2152450]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa44315 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa30271 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24690 Nonsense Available for shipment Available now
sa44314 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30272
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067114 None None 227 None 2
ENSDART00000088884 Nonsense 2 527 1 16
Genomic Location (Zv9):
Chromosome 25 (position 27619591)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26309685
GRCz11 25 26752887
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAATCATTTAAACGTAGACTTAGCTAGTGTAGCTAGCTCACAGATTCATG[G/T]AGTGTCCTCACCTCAACTCCAGTGTCTGCATGACAGTGGATCTCACCCGG
Long Flanking Sequence:
CAAATATTAGAATATGTATCATTATGCAGCAACTTCCCTTAAGCCTAAAAATATTTAATTATTTGTGGAGCAGAAAACGTGTTTCGTTTTACTAGAACGCAACATATGTCTTTTCTCGCCCCAAGGGCATCTTTCTTGCGCTCTCTCTGCTTTTTAGAGCTGAACACAGTAGGTGGCGATAATATCCCTTAAACGTTGGTCCTTCCCGCCGTAAAACCGAAGAAGAAGTTCTCTTTTTAGACAGCATTTTTGATGTATAGTTAGGGAACTTGGTAGGTTTTGAAACAGCCTGAGTCTGTGCGTGCATGTCTGCTATTTTAACCCATAACAACACTGTTTCATTTAACAGACCAGCAATATAGCTCACACATTTAAACGTAAAAGTAATCACCCATTTGAAAACGTATTTTGTGCCTCTCAACTTGCATTTTAAAAATTTAATAATTACAGTAATCATTTAAACGTAGACTTAGCTAGTGTAGCTAGCTCACAGATTCATG[G/T]AGTGTCCTCACCTCAACTCCAGTGTCTGCATGACAGTGGATCTCACCCGGTTCCCCAACGGTTCCCCTTCTTCATGGTGCTGTTCCGGTGAGTTAAATACACATGGTAATGGTGGCTATCTCTTATAATCAGCATTTCAGTCAGTTTCCTGTAACGTTACGCTCGTTAGCCGAAGTGGCTAATTCTTCATTGCTCACAGCAGATCGCGCAGTGAGACTACACATTGGTGCTAATAAAACTAATAATTTTAAGAAGACATCATCGTATACGTATATTAAACACGTAATGTAATTGTGTTAAATTTTACAATGAAAGTAACTGCATTTAATTATAACCCAATTCAAGTAACGTTAGCTTAACACAACATTCAAACTTGCTCAGTTCAGTCTGACACCACTGTTGTTCTTTGAACATATTTTACATTTTGTTTGTTTTTTCAAGGACATAAAACTGATGTCACATTTACTGTATCGCTTGTTTAGCTGATGGCTTTTCATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44315
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067114 None None 227 None 2
ENSDART00000088884 Essential Splice Site 127 527 4 16
Genomic Location (Zv9):
Chromosome 25 (position 27616033)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26306127
GRCz11 25 26749329
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACTTGGGCATGTGCAGAGGGTCAGAGAACATCTACAGAGTTTGGAGAA[G/T]TAAGACTGTAGTTTATAATGTATCTGTTTATCAATCAAACATCATAAAAC
Long Flanking Sequence:
GAATATACAAACATATTTATAACATGTTGAAGTACAATTCTACTGAAATAAATAACATTTAATCATTAAAATATACACACATAAGCATTTAATCTCTTTTCTTTTGTAGGTATGTTAATGGCCATGCCAAAAAGCATTTTGAAGAGATTGAAGCTCCAGGTTGCAGCCAAAGGAAGCCAGACAGAGAAAAGTTGAGGGAGAAGGGTCAACAGCACTCTGTGTGTATGGACTGTAACAGTTATAGCACATTCTGGTAGGTTTCTTGCCCTATTATTCATTCATCATTCATTTATTCATTCATATATTCATTCATTCATTCATATTTGTCAATGGACTTTAAAATTTAATATTGTTCAGTAAGCAGTGTTATATGTTAAAAAAAAACTATTTTTGAGTTTCTTACCTATTTCCTGCAGTTATAAATGCGACGAATTTGTGGTGAATGACACAAAACTTGGGCATGTGCAGAGGGTCAGAGAACATCTACAGAGTTTGGAGAA[G/T]TAAGACTGTAGTTTATAATGTATCTGTTTATCAATCAAACATCATAAAACTTTATTGACATTGTTGTGTTTAAATGGTTTATTCTTTGTCCAGCTCTGTGTGTAATACCGACAGACAGAGAAAGAGAAAAATGTCTGAAAGTTTTTCTCCTGACAGCAAGATGAAGCAAGACAGTGTAAGTTTAATTTGTTTCTATGCATCTTTGCAAAAATGTGCCAAGAAATAGCTTAGAAAAAATATTATGCACCCACCTACACATGCACATCTTTTGAAAAAGTTAGGACACCTTATTTAACTTGGTGGGTTTTTATCAGGAGAAAATAAACGAAATAAAAGTTTAAATGTCATTTTTTACTTAAAAATAAAGCCAAAATTTAAAAAAAGTGATGAGTGATGAGCTTAGGACACTCTTAAAATAGGGATTAAGAATGTAAGTAGCAGTCAAGCACAGCTAGTCAAATGCCATTTAATAAGCTGATCATCAGCAAGTGTGTGCCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30271
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067114 None None 227 None 2
ENSDART00000088884 Essential Splice Site 409 527 12 16
Genomic Location (Zv9):
Chromosome 25 (position 27607395)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26297489
GRCz11 25 26740691
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGCGACAGAAGTCCACCAAGAAATTCTGGATCCAGAAACTGCCCAAG[G/A]TAACCAAATATTTAAATATTTCGGTAATATGTTGTCCATATTTTTTCAGC
Long Flanking Sequence:
GTTTGTGTAGTAATGTTGAGCAATTCTGCAATTGTTTCTAGAAATGGGACATCCACTATTGTTACATCTGTGTTTGGTGGCGTTCTACAGAATGAGGTGTATTGCTTGATATGCGGCACGGAGTCTCGGAAATTTGATCCATTCTTAGGTAAGCATAATTTCACAAAAACTTGACTTTTGTAACTATTGTTGGAAAAGTTCACCTGTCTTATTCTCCTTCAGATCTTTCACTCGACATTCCCAATCAGTTCAGAATCAAAACCACAAAGGACCAAGAACCGGGGCCAACGTGCACTTTGAGTGGTAAAGGATTATCTGAAACGAAGTTGCTGCAGTTTGGTTAATTTTGGGCAGTGTATTTAGTTTTTCTGTTGGTTACAGATTGTCTTCGTAGTTTCACAGACCTTGAGGAGCTCGATGAAACAGAGCTATACATGTGTCATAAGTGTAAAAAGCGACAGAAGTCCACCAAGAAATTCTGGATCCAGAAACTGCCCAAG[G/A]TAACCAAATATTTAAATATTTCGGTAATATGTTGTCCATATTTTTTCAGCTATATGATGTCATATCCCTTTCAGGTGCTTTGTCTACATTTGAAGAGGTTCCACTGGACAGCATTTCTGAGGAATAAGGTTGACACCTATGTAGAGTTTCCCATGTGTGGCCTTGACATGAAAAGCTACTTGTTAGAGGTGAGAGCATTCAGTTTTGTTACACATTGTTTTGTTTTTTTTGTTATTTGTTTCTAATATTTAAATGAACATTACAAGAAAACAAATCATGCCAATATACTGTTATTTATTATTATATGTATAAAAGGATATTAATGAATAAAGTAATATTTATTTACATTGAAAATGCATGTTTTTCTTCAAAACACAGTAGACAAAATGATTGGCATCTCTAAAATTCTAATGAATAAAATATATCTGTGTAATACTTTTCTTTAAGTTTACATTTTTAGCACACTTGAGTGAGTACAAGCACAAAAGAATCCAGGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24690
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067114 None None 227 None 2
ENSDART00000088884 Nonsense 446 527 13 16
Genomic Location (Zv9):
Chromosome 25 (position 27607211)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26297305
GRCz11 25 26740507
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCTATGTAGAGTTTCCCATGTGTGGCCTTGACATGAAAAGCTACTTGT[T/A]AGAGGTGAGAGCATTCAGTTTTGTTACACATTGTTTTGTTTTTTTTGTTA
Long Flanking Sequence:
TATTGTTGGAAAAGTTCACCTGTCTTATTCTCCTTCAGATCTTTCACTCGACATTCCCAATCAGTTCAGAATCAAAACCACAAAGGACCAAGAACCGGGGCCAACGTGCACTTTGAGTGGTAAAGGATTATCTGAAACGAAGTTGCTGCAGTTTGGTTAATTTTGGGCAGTGTATTTAGTTTTTCTGTTGGTTACAGATTGTCTTCGTAGTTTCACAGACCTTGAGGAGCTCGATGAAACAGAGCTATACATGTGTCATAAGTGTAAAAAGCGACAGAAGTCCACCAAGAAATTCTGGATCCAGAAACTGCCCAAGGTAACCAAATATTTAAATATTTCGGTAATATGTTGTCCATATTTTTTCAGCTATATGATGTCATATCCCTTTCAGGTGCTTTGTCTACATTTGAAGAGGTTCCACTGGACAGCATTTCTGAGGAATAAGGTTGACACCTATGTAGAGTTTCCCATGTGTGGCCTTGACATGAAAAGCTACTTGT[T/A]AGAGGTGAGAGCATTCAGTTTTGTTACACATTGTTTTGTTTTTTTTGTTATTTGTTTCTAATATTTAAATGAACATTACAAGAAAACAAATCATGCCAATATACTGTTATTTATTATTATATGTATAAAAGGATATTAATGAATAAAGTAATATTTATTTACATTGAAAATGCATGTTTTTCTTCAAAACACAGTAGACAAAATGATTGGCATCTCTAAAATTCTAATGAATAAAATATATCTGTGTAATACTTTTCTTTAAGTTTACATTTTTAGCACACTTGAGTGAGTACAAGCACAAAAGAATCCAGGCATTACCTTGTCACAAGAGCACAGAGATAGAATTACAACTTCTGTATGAGCCCAGTTAAGAGTATTGAGTACTTTTCTGATATAAATCAAAAGATTCAAAGAAAACAGATTTAAAATATCAAGTATTTAAAATTCCCATTTCCACTAATACAATACAACATTACTTGCAATGAAGTTGAAATAAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44314
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067114 Essential Splice Site 112 227 2 2
ENSDART00000088884 Essential Splice Site 497 527 16 16
Genomic Location (Zv9):
Chromosome 25 (position 27594481)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 26284575
GRCz11 25 26727777
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAGTAGTAATTATATTTAGCATGTCAAAATTGTGCTTTTTGTTTTTTTA[G/A]GTGTCCAAATCTGATCTCACTGACTCTGTCTGGATGTGGGCACATAATGG
Long Flanking Sequence:
GGTGCAATAAATAAAATCTTAGGCTAAATGAATAATTTTATTTGGTTCTTTCTCATAATGTGGCATAGGAGTTAAGATAAATAAATAAAAAAAATACTAGTCATTGTAGTAGTATCAGTAGTAGTGTTAGCAGTAGTTGTTGTGGTAATAGTAGTAGTAGTTGCTGTATTAGTTGTGGTAGTAGTAATTTGTGTACCTCTTTGAATACTACTACTACTACTACTACTACTACTACTACCACTACTACCACTACTACTACTACTACTACTACTACTACTACTAATAATAATAATAATAATAATAATACACCTTTAATAATAAACCTTTGACTTGATTTCTCTCCAGTACCGTGGGCTGACAGAGCATTACTGTACGTTGCAAAACGTCCCCAAAGACTCTTCTGCATTTTAACAATCTCAACAAATTAAACAAACAAAAAATGTTTAGAGCATAGTAGTAATTATATTTAGCATGTCAAAATTGTGCTTTTTGTTTTTTTA[G/A]GTGTCCAAATCTGATCTCACTGACTCTGTCTGGATGTGGGCACATAATGGACAACAATGTCATCAAAGTGCTACAAAGCTGCAGAAGGCTACGTAGCCTGAGTCTAGAAAACTGTGCTCGGATAACAGACTCTGTACTCAAGGCTGCGGTGGAGCATGGCCACAATCTCACAGAGGTGAGAGTGGACTTTTGCCGCAATGTGACCCAGGCAGGGTTGCAGGAGCTAAAAAACAAGAGACCAGAAGTACTTCTGAGTGCATTACACAGTGCGGATATGATTCCAGATTGCAAGCCTGAGGAGAAAACACATATCAAGAGAGCTCTGCAGAAGTTCTTGATCTTCTCTTGACTGACCGTTGTGACCTTATGTCAAGATGATATTTATTTTCTAATTCTATTATAAATGTTTTTTTTCACCAATTTTTTGATTCCTTATTTTATGACATGCTAATTTTATTGCTAACATTTTATATTTTATTAGTTCCCTCTTTTCACCCACC
Associated Phenotype:
Not determined