Busch Lab

ZMP

slc13a1

Ensembl ID:
ENSDARG00000045638
ZFIN ID:
ZDB-GENE-031222-3
Description:
solute carrier family 13 member 1 [Source:RefSeq peptide;Acc:NP_954975]
Human Orthologue:
SLC13A1
Human Description:
solute carrier family 13 (sodium/sulfate symporters), member 1 [Source:HGNC Symbol;Acc:10916]
Mouse Orthologue:
Slc13a1
Mouse Description:
solute carrier family 13 (sodium/sulfate symporters), member 1 Gene [Source:MGI Symbol;Acc:MGI:18599

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa45856 Nonsense Mutation detected in F1 DNA Not yet available
sa32538 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa996
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047007 Essential Splice Site 218 583 7 15
Genomic Location (Zv9):
Chromosome 25 (position 28793737)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27483831
GRCz11 25 27927033
KASP Assay ID:
554-0900.1 (used for ordering genotyping assays)
KASP Sequence:
CAAAATCCTTSTTTCTGCCTGTATAAAATGGTATTTCTCAATAACTTCCA[G/T]GCACCGACTCCACCGTATAGTGGAAAGTACAGGACCCGCGAAGATCACAT
Long Flanking Sequence:
AATATAAAATTATACTTGAATACTAAATCATCTTTATTTTTTTGAAGTATGCCTTAAATAATTACAGATTCCCATTTAACATGTTTTCTTGTTTTGTTTTGTTTTTTTACAATAAAACCAAAATCAAAGTGTAGTAGTGTAACAAGATAAGGTATGTTTGTCTGTTTTGTAAACCAACAATGCAGTGTATAGAGTAACCATTATTTATAAGAGTCATTCTTTAAATGACTTTAACAGTCATTATTTAAGACAGTCAACATATGTTCCAGTTACTATGACCATTTATGTGAAGCTGCTTTGACACAATCTACATTGTAAAAGCGCTATACAAATAAAGCTGAATTGAATTGAATTGGTCAACTATTTGGTAGAGCAAGCAGTTGAAGAGATACGTGTTGTGTATTATGAGGATACAATGCATATCCTCATAAACATAAACACAATGACATACAAAATCCTTGTTTCTGCCTGTATAAAATGGTATTTCTCAATAACTTCCA[G/T]GCACCGACTCCACCGTATAGTGGAAAGTACAGGACCCGCGAAGATCACATGATGTGTAAAGGCTTGTCACTTTGCATTGCCTATTCATCATCCATTGGGGGGCTGACCACATTATCCGGAACATCCACAAACCTCATATTTGCTGAATACATCTATCAGTGAGTTCACTGCTTATCTTAAAAACAACATGTGAACCATATGTTATCATTATGATGTTCTCATTATTTCTTTTACATTATCTAATTTGGTCAGTCTGAACAGTGCTTGTGGTGCACTTTTATTTCATTTCCTTAGGTACTACCCAGAATGCACCATCGTTAATTTTGGAAACTGGTTCGTGCTTTGTCTTCCCATCTGCATAATTATGCTGATTTTGTCATGGCTGTTCCTGCACTGGATGTACCTCGGATCCAAGTGAGTGATTGTAATGTCATGTTTTCAATAAGTCGTTCCCTGACCCATCCCTGTCCCTCATTTTTACTCTTCGTCTTTGGCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45856
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047007 Nonsense 498 583 14 15
Genomic Location (Zv9):
Chromosome 25 (position 28797877)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27487971
GRCz11 25 27931173
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAGAGCTACTCTCATCAAAAAAATTATCTTTGTCAGGCCGAGGCAATC[G/T]GAGTCAACCCTCTGTACATGCTGATTCCCACGGCTTTGGCTGTGTCCTTC
Long Flanking Sequence:
AGAAAGGGTGACTACTGTGCCACATTCTCCATATGGAATATCAGGGTGTCCGGATCCCATATCTTGACAAACAGCTAAATTACGACTTCAGTCTCTGTTGACGAGCATACAAAGAGATGTTAGTACATTTATGAAAGCAGGTTCATATGAGTTCATTAATATTTTGGCTAAACACATTTACTTACCTTAGAGTGTATGTCTTCCAAAGACGAGCTGACATTTTTCCCTTCGTTTGTTTCACCCCACAGATTTCTGGTTTATCGTCTTGGGTCGCTGAATTGTTAACTCCCTTGGGAAGTCTTCCACCTTTAGCTACTGTCACCATTGCCTGCCTTATTGTCACATCTATCACAGAGGTTGCCAGCAATGCTGCCACAATGACAATCTTTTTGCCAATACTGGCACCCCTGGTATGTGTTATTTCAGCATATGTACAATATAATGTCACCTTTTAGAGCTACTCTCATCAAAAAAATTATCTTTGTCAGGCCGAGGCAATC[G/T]GAGTCAACCCTCTGTACATGCTGATTCCCACGGCTTTGGCTGTGTCCTTCTCATTCCTGCTTCCGGTTTCTAATCCCCCTAATGCTATCGTCTTCACGTATGGTCATCTGACTAGCATGGATATGGTGAGTCCTTATGCTTTTTTGCTCTTTGCAAGCTGTTTTGGATTGTAAATGGAATCACATAGAGAATGTTTTTCGAACATTTCATAACAATCCTTAAAAGTTATGAAATTAAAATAATGTTTTTTTTCTATATATATTCTTGTAATGTTGATAGAAAAACATTCTCAGAACACTAATATAATGTGAACGAAATGTTCTAATAACTTTTTAAATAATTTTGTGAGAACATTATTATAACATGAAACTGAAACATTTTGAATAATGTTTTTATAACCAAAAAATCACATTAATACATTAATTAATACGTTCTCAGAACTGTGCACAATTTTTATAGCTTACTGAGAATTATAGGGAAAAGCTCTTTTGTATACTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32538
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047007 Nonsense 582 583 15 15
Genomic Location (Zv9):
Chromosome 25 (position 28798768)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27488862
GRCz11 25 27932064
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTTAAGTTGGATACCTACCCAGACTGGGCACCGGTGGTAAACAGCACT[G/T]GAGTATGACCATAATTCTGAGCATTTTAGAAATGTGAACATTTAGTTTTT
Long Flanking Sequence:
TTTTATAACCAAAAAATCACATTAATACATTAATTAATACGTTCTCAGAACTGTGCACAATTTTTATAGCTTACTGAGAATTATAGGGAAAAGCTCTTTTGTATACTGGCTGGAATGTTCTCATAATGTTTTAAATAAACTCTAAGAGTTTATTATTATAACACGAGACTGAACAGTTGAGTAATGTTTGTGTGAATGAATTTTTTTTGATAATATTATTATAAACAAAAAAAATAATGGTAAAAAATTCATCTCAAAAACTGGATGTTTGAAGGTTCTAAGAACCTTTTTAGTAACCTAAAATTGTTGGCTGACAATACTTTTATTCCATTTTACAGTAACTAAGCTTGTTTTTTTCTTTTTTGACTTTGTAGGTAAAAGCAGGGCTGGGTGTGAATGTTATAGGTATTCTTACAGTCCTTTTAGCTCTCACAACTTGGGGAACACCTCTGCTTAAGTTGGATACCTACCCAGACTGGGCACCGGTGGTAAACAGCACT[G/T]GAGTATGACCATAATTCTGAGCATTTTAGAAATGTGAACATTTAGTTTTTAAAATACACGGGATCCCAATTGCAGTTGACAGTACCTAATCCACAATCCATTAGTTTCATTCCTTTGGATCACTTGCACAAGAAGCTAAAACCAGCCTACCTTATCCAATACAGCAGACTGAAAACTGGGTTTGCAACGTGTGTGTTTATATGTTTTTGTATTATAATAATATTTGTGATTATACAGAATGTGTTATATAAAATGTATGTTTTAAGCTTTAAGCTGAGTTTGCAAGACAGGGTTAGTCTTGTTGTCTAACCATAGCACTTAATGTTTATAAGATTGTATATTTTTGTTATCCTCTAGCAGGTACTTGTACATAGATATGTGAATAGTATGTGTGGAATGTTGAAAAAAATTAACAAACAGCTTAGATAAAATTCACCTCTCAGAATGCTATATATTTTAAATGGAAACTCAACATCATTGTTTATTTTACTTGTTCATAT
Associated Phenotype:
Not determined