Busch Lab

ZMP

rbl2

Ensembl ID:
ENSDARG00000045636
Human Orthologue:
RBL2
Human Description:
retinoblastoma-like 2 (p130) [Source:HGNC Symbol;Acc:9894]
Mouse Orthologue:
Rbl2
Mouse Description:
retinoblastoma-like 2 Gene [Source:MGI Symbol;Acc:MGI:105085]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa14836 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8068
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073432 Essential Splice Site 178 1079 4 22
ENSDART00000073432 Essential Splice Site 178 1079 4 22
Genomic Location (Zv9):
Chromosome 25 (position 37127650)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35535266
GRCz11 25 36040205
KASP Assay ID:
554-5584.1 (used for ordering genotyping assays)
KASP Sequence:
CGTCACTGAGGTCTTCAACTTCTGCTGGATCCTCTTCATACACGCTAAAG[G/A]TACAGAAACGCTACATTTATANNCACACTTGCTGCATCTCAATCTGCRCG
Long Flanking Sequence:
TGTCTTCCAGCCTGATTGAGTTCTTCAGTAAGATGAAGAAGTGGCAGGACATGGCGAATCTGCCCAGAGACTTCCAGCAGAGCACAGAGAAACTGGAGAGGAACTTCACCGTCACCTCCGTCATCTTCAAGAAATACCTGCCCTTATTCAGAGACATCTTCAAGACACCCACGGACGAGTTACCCAGAACACACCGGGGCAGAAAACAGAGGTATACAGACTGATGATTAACCGTTGTGTACTGTTGGGGGCTGTTTTTGCCCCATTGACTTCCATTATAATCACATGTTATGATTGCAAAGCCATGACAGCATATACTCATGCATTCTTGACTGTTGCTGGTCTTCCCTGTTGGGAAGAAGCATAAAGGCTTAAGGAGACAAAAATGACAAAAAAAACCTTACTGTGTGAATAATTCAACATTTGTGCCTCCAGACGTCATCCCTGCACCGTCACTGAGGTCTTCAACTTCTGCTGGATCCTCTTCATACACGCTAAAG[G/A]TACAGAAACGCTACATTTATAAACACACTTGCTGCATCTCAATCTGCGCGCTAGCTCCTGAGCTCGTTCAAAATTAGGTTGTGTCCATGAATTCCAGCACTAGTAAGGGCACAATGAGGTCGGTTTACTACATAGTGGGACACACTGAGTGTGACATGAGAGCATCATCAAAACTGGAGTTTATAAACACACACACACACACACACACTATGGCCAATTTAGTCAATTCCCCTATAGCGCATGTGTTTGGACTGTGGGGGAAACCCACGCCAACATGTGGAGAACATGCAAACTCCACACAGAAATGACAACTGTATCCAGCGAACTTCTTGCTGCAAACCTATCTAGCCACATTTGTTCATGTTAAAAATAAATAAATAGTGAATTCTTTTTAGAGAAACGTCTCTCGTTTGTCGTTATGTTGGATGATTTGGGTCACGTCAGTCATGTGTTGTGTTTCCGAACTTCCGTTAAGGGCACATACACTCACCGGCCAATTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19374
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073432 Essential Splice Site 178 1079 4 22
ENSDART00000073432 Essential Splice Site 178 1079 4 22
Genomic Location (Zv9):
Chromosome 25 (position 37127650)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35535266
GRCz11 25 36040205
KASP Assay ID:
554-5584.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTCACTGAGGTCTTCAACTTCTGCTGGATCCTCTTCATACACGCTAAAG[G/A]TACAGAAACGCTACATTTATAAACACACTTGCTGCATCTCAATCTGCGCG
Long Flanking Sequence:
TGTCTTCCAGCCTGATTGAGTTCTTCAGTAAGATGAAGAAGTGGCAGGACATGGCGAATCTGCCCAGAGACTTCCAGCAGAGCACAGAGAAACTGGAGAGGAACTTCACCGTCACCTCCGTCATCTTCAAGAAATACCTGCCCTTATTCAGAGACATCTTCAAGACACCCACGGACGAGTTACCCAGAACACACCGGGGCAGAAAACAGAGGTATACAGACTGATGATTAACCGTTGTGTACTGTTGGGGGCTGTTTTTGCCCCATTGACTTCCATTATAATCACATGTTATGATTGCAAAGCCATGACAGCATATACTCATGCATTCTTGACTGTTGCTGGTCTTCCCTGTTGGGAAGAAGCATAAAGGCTTAAGGAGACAAAAATGACAAAAAAAACCTTACTGTGTGAATAATTCAACATTTGTGCCTCCAGACGTCATCCCTGCACCGTCACTGAGGTCTTCAACTTCTGCTGGATCCTCTTCATACACGCTAAAG[G/A]TACAGAAACGCTACATTTATAAACACACTTGCTGCATCTCAATCTGCGCGCTAGCTCCTGAGCTCGTTCAAAATTAGGTTGTGTCCATGAATTCCAGCACTAGTAAGGGCACAATGAGGTCGGTTTACTACATAGTGGGACACACTGAGTGTGACATGAGAGCATCATCAAAACTGGAGTTTATAAACACACACACACACACACACACTATGGCCAATTTAGTCAATTCCCCTATAGCGCATGTGTTTGGACTGTGGGGGAAACCCACGCCAACATGTGGAGAACATGCAAACTCCACACAGAAATGACAACTGTATCCAGCGAACTTCTTGCTGCAAACCTATCTAGCCACATTTGTTCATGTTAAAAATAAATAAATAGTGAATTCTTTTTAGAGAAACGTCTCTCGTTTGTCGTTATGTTGGATGATTTGGGTCACGTCAGTCATGTGTTGTGTTTCCGAACTTCCGTTAAGGGCACATACACTCACCGGCCAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14836
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073432 Essential Splice Site 615 1079 14 22
Genomic Location (Zv9):
Chromosome 25 (position 37109382)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35516998
GRCz11 25 36021937
KASP Assay ID:
1641-0496.1 (used for ordering genotyping assays)
KASP Sequence:
AGCAGCAAGACTGAATTCAGCGGCAACATCGCAGCGGGAGCAGGAAAAGG[T/C]GATTTACAGTACTTGMAKGCGAACTGAACGCAAGWTAATATCTAWRAACA
Long Flanking Sequence:
GTGACGTCACGGACACTACGTCCATATTTTTTCAAGAGTTGACACCTAGCTGATGATTGATTATAAAGCTTGTTTGCCATGCTGTCCCAGGAGAGACCCCTGAGCTCATAAGATCCTCGAGCCTGGGGCTCCCTCCCGTTTGCAAGGCGAGAGGGGAGTTTGTGCTCTGGTAGATCTGGAGAACTCCCCTGCGGTAGTAGCTAATGAACAGAGAGTGATCTCTCTTAAGAGATAACTACTTACTAGGAACATGTCTATGGTGCCGATTTGAACTCGCACGCGATCCTCTCCAAATTAGTTTATAGATACACTTCACTTACAGTCTATGGTTTTGACACATTACAAATATGTGGCTAAAAAATAACCAGGGTTAAAATATGAATATGCGTCTGACAGGTAATGCCACCTCAACACCTAGAGGACGGTTCAGGAAGCAACGCAAACACCCCAAGCAGCAAGACTGAATTCAGCGGCAACATCGCAGCGGGAGCAGGAAAAGG[T/C]GATTTACAGTACTTGAATGCGAACTGAACGCAAGATAATATCTAAAAACATTCACTGAATCACATCTAAAATATTCATCTGCCATTTCCCCTCAGGAGTTTCTCCGTCCCCTACATCTCTCCACGACCGCTACAGTTCTCCCCCTACTGGCACAGCAGTTCGTCGTCTTTTTGTGGATGGAGACACGACGCCAGAACCTGCTCCACCTGTCAAAGTGGCACCGCCGTCTATAGTCAGCTCCATCCCAGCAGGACAGACTGTGGTTACGATGGCAACAGCTACTGTCACAGCGAACAACGGCCAGACTGTTACCATACCTGTTCAAGGTGCGAAATTATCGACAAAATCAAAACATTCATTTAAATCATTCAGGCACAAGCAATTATATCATCTGCCATCTTTATTAAAGATCAATTGTAATTAATTAACTGTACAATACTTAACTGTATTATACAATGCTATTTTCTCTACTGAAAAAAACAGCTTAAACCAGCCTAGGC
Associated Phenotype:
Not determined