Busch Lab

ZMP

alkbh3

Ensembl ID:
ENSDARG00000045606
ZFIN ID:
ZDB-GENE-040801-254
Description:
alkB, alkylation repair homolog 3 [Source:RefSeq peptide;Acc:NP_001003511]
Human Orthologue:
ALKBH3
Human Description:
alkB, alkylation repair homolog 3 (E. coli) [Source:HGNC Symbol;Acc:30141]
Mouse Orthologue:
Alkbh3
Mouse Description:
alkB, alkylation repair homolog 3 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1916363]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa16257 Essential Splice Site Available for shipment Available now
sa25232 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3311
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067057 Essential Splice Site None 282 1 10
ENSDART00000123220 None None 282 None 9
ENSDART00000145924 Essential Splice Site None 181 1 8
ENSDART00000147327 Essential Splice Site None 115 1 7
ENSDART00000148250 Essential Splice Site None 91 1 7
Genomic Location (Zv9):
Chromosome 25 (position 31223419)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29790780
GRCz11 25 30233787
KASP Assay ID:
554-3137.1 (used for ordering genotyping assays)
KASP Sequence:
CGTTGAATCTTGAAGAATACATRGATCAAACRGCTTGAAACGAWTGTTTG[T/A]AAGTATTAATWTAGTTGATAATGTTTAGGNNAAAAACTGTCGCGTCATWGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16257
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067057 Essential Splice Site 26 282 3 10
ENSDART00000123220 Essential Splice Site 26 282 2 9
ENSDART00000145924 Essential Splice Site 26 181 3 8
ENSDART00000147327 Essential Splice Site 26 115 4 7
ENSDART00000148250 Essential Splice Site 26 91 4 7
Genomic Location (Zv9):
Chromosome 25 (position 31230288)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29797649
GRCz11 25 30240656
KASP Assay ID:
554-7145.1 (used for ordering genotyping assays)
KASP Sequence:
RTAGAAAAAAAGGTRAATTGAATTGAAYTGAATATATTTGCGTTCTTTCA[G/A]YTCAAGATGTCCANNNNNNATCAGCATCAGGATCATGGAAATCTGGACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25232
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067057 Nonsense 69 282 5 10
ENSDART00000123220 Nonsense 69 282 4 9
ENSDART00000145924 Nonsense 69 181 5 8
ENSDART00000147327 Nonsense 69 115 6 7
ENSDART00000148250 Nonsense 69 91 6 7
Genomic Location (Zv9):
Chromosome 25 (position 31230583)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29797944
GRCz11 25 30240951
KASP Assay ID:
554-7719.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGATCCAGCGTGTTGTTTTTCTTCTCTTTCTCAGAAATGCTGGTGACTA[T/A]GAGATTAGTCAGGGGCCTTCTGGAGTATCCCGGTAAGAATAATGAATTTT
Associated Phenotype:
Not determined