Busch Lab

ZMP

ticrr

Ensembl ID:
ENSDARG00000045605
ZFIN ID:
ZDB-GENE-040728-1
Description:
Treslin [Source:UniProtKB/Swiss-Prot;Acc:Q6DRL4]
Human Orthologue:
C15orf42
Human Description:
chromosome 15 open reading frame 42 [Source:HGNC Symbol;Acc:28704]
Mouse Orthologue:
5730590G19Rik
Mouse Description:
RIKEN cDNA 5730590G19 gene Gene [Source:MGI Symbol;Acc:MGI:1924261]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa440 Nonsense Confirmed mutation in F2 line Not yet available
sa8433 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa440
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067056 Nonsense 253 1823 2 23
Genomic Location (Zv9):
Chromosome 25 (position 31308426)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29875787
GRCz11 25 30318794
KASP Assay ID:
554-0292.1 (used for ordering genotyping assays)
KASP Sequence:
ACTACACTGGCATAGAGACTCTGATGGAACGTCTTGGGCTGGTTGGTGGA[C/T]AGGTGGTGCCAATGTTGTCTCCTTGTTTACCACTGATGGACCAGCATCCT
Long Flanking Sequence:
TTTAGAACAGGCCCGCGGGCACCATCTTGGTGACCCCTGCTTTAGAGTTTCCACATTTTTCTGAACTCTAGTGTGGTTAACTTTAATCAAGACTTGATATTGCAGATCCTGCAATGTGACTATTGTGGATGTGCAAACTGCAGTATTGATACTGAAATAATATGTGGTGTAGCCCTACTTTACATGTTTTAGGGTTTTTTGTACGCAAAATAATCATTTAGCAAAACGTTAAAAACCGATAGCCATTGACTTTCATAGTTTTTCATAGGATGTCAATGAATATGAATTTCCAGTGTGTTCAACAGAAAAAAAGTGTTTGGATTCGCTTAAGGGTCGTTTAGGTCTTCATTTATGGGTGAACTATCCCCTTTATGCTCCAATTTTTTAAATGACTGTTCATTTTCTCTTTTTTTTTTTTTTTTCCAAACCAGGCTGATCATGTGGCGAAGGACTACACTGGCATAGAGACTCTGATGGAACGTCTTGGGCTGGTTGGTGGA[C/T]AGGTGGTGCCAATGTTGTCTCCTTGTTTACCACTGATGGACCAGCATCCTAAAATGAACTCTTTACTGGCTTTGGGAGTGGATGCATTTCCAATAGATTCCACAAATAGCTACCTTCACTTGTCTAAAAGAATGCAGCAACAATTGTTTCCTCCACTAGGAGCATCTTTTTCCTGGATTGCAGGTAAACGTATAAAATTGGTATAGTATTTTTAAAATAGTATTTTTTATAGGGATGCTCTGATTGATCAGCCGGAGATTGGTATCGGCTGATATGATAATCACTTTTAATGATCGTATCAGTAGTCGCTGAGCTGAGGTTCGTTCTTCGTACGAGGATTGCTCAGTTAGCTTGATTTGGGTATTGACGACACGATCCAGGATTGTTTCGTTCTTCAAAACTAATCAAAGAGTTGTTGTCATAGCAACAGTTCCGGTAGCTCAAACCTGGTCTGGAGCAGGCTCATTTCATATAAACAAGATTAGATCTGCCCAGTTCAA
Associated Phenotype:
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal.
See FAQs for more info.
Control on top; Mutant below; 5 dpf
Control on top; Mutant below; 5 dpf
Stage Entity Quality Tag
Larval:Day 4
ZFS:0000036
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
head
ZFA:0001114
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Larval:Day 4
ZFS:0000036
integument
ZFA:0000368
detached from
PATO:0001453
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa8433
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067056 Nonsense 1303 1823 21 23
Genomic Location (Zv9):
Chromosome 25 (position 31321001)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29888362
GRCz11 25 30331369
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGAATCCGGGTCCTTTCCTTTTTGCAATTCTCYATTGAAACCAAATATA[C/T]AAAAAACAATACAAAGCCCCATCCYAACACACAGAATGTGCACTCGCTCT
Long Flanking Sequence:
AGACACCCATGAAAAGCCCACTGAAGGGGATACTCAAGACTCCGATTAAAAAAAGCCTCTTGGATTGTGTTTCTCCAAATGGTGCTTGGCTGAGGAGCCCAGGTTGTAAAACACCAAAGAAGTGTGTGACATGGTCTCCATCGCCACGGAAACCTGTGCCAGAAAACCAGGTCAATGTGCCAGATTCTCCGGTGTTTGCAAAAAGACACTCACCAAGGCTGGTTACACCTGGCAAAAATAGCAGCCCAGAGGAAAAAATTGTTTTTAAAACGCCTGACAAGGTGCCCCAAAGGAAATCTAAGACATCTCCTGAAATTATTCTCAGGAGACTTGAAATTCCTGTAAATATTGACCCTGAAACATGTAAGTCTATTACGAGGTCAGGAAAGATAAGAACACTGAGCTTACCTTACAAAACAAGTAAAGGGTCAGATGAGTTTTTACCTCAGTCTGAATCCGGGTCCTTTCCTTTTTGCAATTCTCCATTGAAACCAAATATA[C/T]AAAAAACAATACAAAGCCCCATCCCAACACACAGAATGTGCACTCGCTCTGGTAACACACCCGTGAAAGAGTCTTGTTCACCCTCTAGCAACTCTCAGGGCATAACAGGTACTAGCCCTTCACCTCGTAAAAGTCTGTCTTCGACTGTAGCAAAATCAAGTCCATCACCATCCTTTGGTCCATCTAGATCGGGTGTCAGCAATCAAAATAATTCATCCATCAGTAATGTGGAAAAGCATACAGATGATAATGAATTAATTGTGCAAAACAAGGCCAACGATGAAAAAGCAGAAGAGGCATCATCTTCTGACTCCCAGCAGTTTGATTGCTCTGAATTCAGCATTACAACAGATGATGAAAGCATTGACATATCAGAGGCCGCAGTGGTGAAGACCCAGCTTGTTGGAGGCATCAAGATGAATATTGCATTCTCAAGGAAACCCTCTAAATCAGACGTTTTTGAATTTGAGGGCAAACAAACTACCTCGACTGGTACACCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30281
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067056 Essential Splice Site 1793 1823 22 23
Genomic Location (Zv9):
Chromosome 25 (position 31322594)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29889955
GRCz11 25 30332962
KASP Assay ID:
2261-9865.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTTATACAAAAAATCAGCTGTAATCAAGGAAGCAACACAATTTAGTGG[T/A]AAGAAAGTGGTGTATGTTAAATAGTGTTTTACCTAAATTGATTGTAATTA
Long Flanking Sequence:
TCATCAAAGGTGTTCCTCTGCTAGAAAAGACTGGAGTTATTGAGGACCCAGAGCTTGAAGGTATTTTCCGAATTCAAGGGGTGGAAGAACTCAAGGAGTCGCTGAGCACCCCTATTAGTCAAAGAAAACTGGGTTTGAGATCCAGCCAGGTGATGGACCATCAGGGATCTCCTGAAGGAATGGACTGGACTGAAACTATGGCACAAATGTGTGATGCTAAAGACTCTACAAAGACTGAACAGTTTGCATGGATGGGCAGAAAAGGTATAGTAAAACTTTGGTGCAGTACATAGCATGTTTCTTTTTAATGTTATATTTATATTTAATGTTTATTTGTTTATTTTAATTAATTTTTTACAAATGCCATGACTCGGATGTTTTGCAGTGGACACTCCGAAAGTAAAGAAACAAGTGTCTGCCAGTGGAATCTTCGCTCTCACTCAGTCACCACTCTTATACAAAAAATCAGCTGTAATCAAGGAAGCAACACAATTTAGTGG[T/A]AAGAAAGTGGTGTATGTTAAATAGTGTTTTACCTAAATTGATTGTAATTACTCACTCTGATATGGTTCCAAACCACCAAGACTTTTTTTTTTTTTTACATCTTCTGAACAGAACATAAGGTATTTTAGATTAAATCCGAGAGCTCTCTGGTCCTCCATAGACAGCAGTGATCCCACCTCATTCAAAGTCCAGAAAGATACTAAATAATTGTCAAAACAGTGCATGAGTCTTCATTGAAAAACTTTAAAGCTACAAAAACACTTTAGTTTCTTCTTCTCATTGTCAGTTAGAGGTGCAACAATTAACCGGTTTCACTATTAACCGCGCTTTAATTAGTCACGGTTAATTAATCGTGAAGGTTTCTCAACACTGCGTTTGTCAACAAAACGGCTACAGCTAAACTTTGTCATATGTGCGCTAGTTTAAACGTCTGAGCTTGTAAACTGAGGCTAATACCCACGCACACTGGATTAACTATGGCTCTTAACTAATAAGGGCTG
Associated Phenotype:
Not determined