Busch Lab

ZMP

cax1

Ensembl ID:
ENSDARG00000045601
ZFIN ID:
ZDB-GENE-030131-3044
Description:
cation/H+ exchanger protein 1 [Source:RefSeq peptide;Acc:NP_001020678]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa40258 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa10712 Nonsense Available for shipment Available now
sa40259 Nonsense Mutation detected in F1 DNA Not yet available
sa1143 Nonsense Available for shipment Available now
sa9985 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa40258
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067046 Essential Splice Site 24 764 1 20
Genomic Location (Zv9):
Chromosome 4 (position 14047358)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14983211
GRCz11 4 14981966
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGTCCGTTGATGTGGAGAGTCGGAGGCGACGGTCCACCGAGAGCTCAGG[T/G]CAGTATTATAATCATCTTTACTTGTTAAGAATCTCCAACCGTTTTAATGA
Long Flanking Sequence:
GGTTCAATGACTCAACAGTAAAGGTTTGTCGCCACCTTCTGACGTAACGAAAATAAAACGTGAATTTATAAATTTTTGTCCCAATATAACGACAGTAATCTCAAATAATTTAGTTGCAAAATAAAGATAATTTAATCTTTTAATTCTATAATAAAAAATATGAATTGTGAATGTGTTCTCAAGCTGTTATGATTTTAATCTTGCATTGTTATGTACATAAATGTATTATTGTTTTTAGTAGAAGTAGTAGCAACCCATAGGTTCAGTTGGATTATTACTGGAATAACAAAAAAATAAAACTAAAAAACTAAATATAAGGAGAGCAAGCCATTGGTGGGAAGCGCGCTCCCAGCAGGCGTCGGTGGCGCGCAGGCCGTGGCTACAGATGGGCTGATGGTGGAGGCGCGCGCCTGAAGCAGGAGGATCAGTATGGCTCAAATCAAACCCACGATGTCCGTTGATGTGGAGAGTCGGAGGCGACGGTCCACCGAGAGCTCAGG[T/G]CAGTATTATAATCATCTTTACTTGTTAAGAATCTCCAACCGTTTTAATGAGGCTCAAATACTTTATACATCTTATTATGGCTTAATTAGGTAGCCTGGACCTAGTTTCCTCCACTTTCAACCTGGGTTTGTTTGTTTTGGTACCAGTGATTTCCCATATCTGGAATCATGTTTGAGATTTTTAGTGATGAAAAGTGTAAAAGCTGCTAGTAATTTTAGGATCTTTAGATAAATAGAAAAAAAATCGTGTTTATTGTTTAATAGTTGAAATGTGTCACACCTGTAAGGAGAGACAGGTTTCACCTGTTATACCAACAATAGTGTCTAAAGTTGCTGTTTTATTTCTTTAAATACTAAGAATTTGCATGTACAAACATAAGTGATAAGCATGCTAAATGTTTTATTTTTCATTTAAATCTGCCACAAAGTTTAAGACAATTATTTAATCAGATTATTTCTCACAAATGAAAAAAATGATCTAAATTATTTATTAAAAAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10712
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067046 Nonsense 174 764 5 20
Genomic Location (Zv9):
Chromosome 4 (position 14049607)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14985460
GRCz11 4 14984215
KASP Assay ID:
2259-4734.1 (used for ordering genotyping assays)
KASP Sequence:
TATAGTATATGTGTTGCTATTTGGGTGGTGGATCTCCTTGTTTTATTTTT[T/A]GGTTGGTTTGCTGATGTTTTTCACCATYGCTGGCATCCCATATGGTAAGT
Long Flanking Sequence:
ATTGATTAAGTACAAATTATCTGTCAGTTTTATTGTTCACATTGTTAATAATAAAAAATAAAAGTAATTTCAGGTTCATTAATTTTAAAACATGCAACTTTTGGTTTTAATTTTGTTTTAGTATATGTTGAAAGCAACCAAGCTTAATAACTGCATTAGATAAAATATTAATAAATAAATTAGAAGTTAGCTTTAACTATTTTTTAATGTTTAATATTAACAAATCAAAAGTGTTACCAGAAAATTAGATTAACCCAAGAAATTACTTGACATTTCAACTGCTCTTGAATGTTTCTGCAAATAAATGCTATTGCAATGTAGATTTAAAACTATACATATTAAAACAAATGACATTAATTTTGAATAAAGCACAAGTGCACCTTTCACCTCTGTTTAAGCGTAATTTTTAAACTTTCTTTTACTCTTAGGATCTCTGGTCACTGCTGGAAATATAGTATATGTGTTGCTATTTGGGTGGTGGATCTCCTTGTTTTATTTTT[T/A]GGTTGGTTTGCTGATGTTTTTCACCATCGCTGGCATCCCATATGGTAAGTCAGGATTCATTTGTTTAATGGTCCAAATCTGTTACATTTTGACACTTTATTCTCACTGAAATCTGCCTTTTTGGTTTGTTTTAGGAAAGCTTTGTTTGCAGCTGTCAGGGTATTTCATATGGCCATTTGGAAAAGCATTGCAGAAAGTAAGTGAAAAAGCATCGTCATGTTCCGGTATCACATTGTTAAATAATTTTGCGAAGCCAAGTTAAATAAACAATGATTATGCCTGCAGCATGTCTTCACATTTTCCATGTTGTAATTGATTTTAACGTAGTCATTTGTGAAACTTTCAAATTTCAAACCTGAATGTGATTTTTCTCTCATGGCCCTTCAGAGCAGCAGTCTGGTTAAGAGATGTTGTGTGAAATTCCCCCACTGTGAGGCTATTCCAGAGGAGGTGGACGAGGTGAAGGAGCCTTTAAAAGAGTCCACACCTCTGCTGCACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40259
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067046 Nonsense 194 764 6 20
Genomic Location (Zv9):
Chromosome 4 (position 14049756)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14985609
GRCz11 4 14984364
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCTCACTGAAATCTGCCTTTTTGGTTTGTTTTAGGAAAGCTTTGTTTG[C/T]AGCTGTCAGGGTATTTCATATGGCCATTTGGAAAAGCATTGCAGAAAGTA
Long Flanking Sequence:
ACTGCATTAGATAAAATATTAATAAATAAATTAGAAGTTAGCTTTAACTATTTTTTAATGTTTAATATTAACAAATCAAAAGTGTTACCAGAAAATTAGATTAACCCAAGAAATTACTTGACATTTCAACTGCTCTTGAATGTTTCTGCAAATAAATGCTATTGCAATGTAGATTTAAAACTATACATATTAAAACAAATGACATTAATTTTGAATAAAGCACAAGTGCACCTTTCACCTCTGTTTAAGCGTAATTTTTAAACTTTCTTTTACTCTTAGGATCTCTGGTCACTGCTGGAAATATAGTATATGTGTTGCTATTTGGGTGGTGGATCTCCTTGTTTTATTTTTTGGTTGGTTTGCTGATGTTTTTCACCATCGCTGGCATCCCATATGGTAAGTCAGGATTCATTTGTTTAATGGTCCAAATCTGTTACATTTTGACACTTTATTCTCACTGAAATCTGCCTTTTTGGTTTGTTTTAGGAAAGCTTTGTTTG[C/T]AGCTGTCAGGGTATTTCATATGGCCATTTGGAAAAGCATTGCAGAAAGTAAGTGAAAAAGCATCGTCATGTTCCGGTATCACATTGTTAAATAATTTTGCGAAGCCAAGTTAAATAAACAATGATTATGCCTGCAGCATGTCTTCACATTTTCCATGTTGTAATTGATTTTAACGTAGTCATTTGTGAAACTTTCAAATTTCAAACCTGAATGTGATTTTTCTCTCATGGCCCTTCAGAGCAGCAGTCTGGTTAAGAGATGTTGTGTGAAATTCCCCCACTGTGAGGCTATTCCAGAGGAGGTGGACGAGGTGAAGGAGCCTTTAAAAGAGTCCACACCTCTGCTGCACTCCGGTCCTGCTGTCACTGCTGAAATCCCTGTGCCTGCACCACCCACCAAGCCCACACGTTACTGGGTGAGATTTAAGCGATCTTTTCTTTAAACTTATTTTGTCTAATTCACTTAAAAATGGCCAGACGGTTCAGCGGATCTTTTTTGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2185
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067046 Essential Splice Site 268 764 7 20
Genomic Location (Zv9):
Chromosome 4 (position 14050172)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14986025
GRCz11 4 14984780
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGCTGAAATCCCTGTGCCTGCACCACCCACCAAGCCCACACGTTACTGG[G/A]TGAGATTTAAGCGATCTTTTCTTTAAACTTATTTWGTCTAATTCACTTAA
Long Flanking Sequence:
TTAATGGTCCAAATCTGTTACATTTTGACACTTTATTCTCACTGAAATCTGCCTTTTTGGTTTGTTTTAGGAAAGCTTTGTTTGCAGCTGTCAGGGTATTTCATATGGCCATTTGGAAAAGCATTGCAGAAAGTAAGTGAAAAAGCATCGTCATGTTCCGGTATCACATTGTTAAATAATTTTGCGAAGCCAAGTTAAATAAACAATGATTATGCCTGCAGCATGTCTTCACATTTTCCATGTTGTAATTGATTTTAACGTAGTCATTTGTGAAACTTTCAAATTTCAAACCTGAATGTGATTTTTCTCTCATGGCCCTTCAGAGCAGCAGTCTGGTTAAGAGATGTTGTGTGAAATTCCCCCACTGTGAGGCTATTCCAGAGGAGGTGGACGAGGTGAAGGAGCCTTTAAAAGAGTCCACACCTCTGCTGCACTCCGGTCCTGCTGTCACTGCTGAAATCCCTGTGCCTGCACCACCCACCAAGCCCACACGTTACTGG[G/A]TGAGATTTAAGCGATCTTTTCTTTAAACTTATTTTGTCTAATTCACTTAAAAATGGCCAGACGGTTCAGCGGATCTTTTTTGTGAACACTGCTAGCAGACAATCAAGTTACTGCAGGCTCATAGTCAATCTTATCTGCAAGACTTTTCCACATCTGGCCAATTCTTACAGTATGTTTATATTTCAGGCAATTCTTTTAATGTTGAATTGTAAAAATGGAACCACTGAATAAAGGTAGATTAGATTAGTTAATTTTACTTTCTTTATTGTCTACAAGTGGAAATTTATCTTTGGCTTCAACTCACAACCACATCAACGTTCACATCACGCATATCACTGAAAACGAACAACACAAATAGTCAATGTCATCACATAAATCACATTTAAAATCTCAATTAACCCTATTCCAATTAACATTGTTTCATATACTTGCAAACTCTGAGTTTTACATGCATTTACTCTGCTTGTCCCATACCAGTTTGAGGGTCTTTTTTTCTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1143
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067046 Nonsense 452 764 11 20
Genomic Location (Zv9):
Chromosome 4 (position 14052081)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14987934
GRCz11 4 14986689
KASP Assay ID:
554-1054.1 (used for ordering genotyping assays)
KASP Sequence:
TTCTACATCACAGCTTTACTCCAGGGTCAGCGTGCGGGATCCCAGTGTTA[T/A]GCAGAACTTGTCAAATCTGCTCTYACAGGCACCCTGCTGGGCTGTATCCT
Long Flanking Sequence:
GAAAACCTAATTCTGAATATAATGTACATTGTAAATGTGTTAGTCCTAAACAACATGAATTCAGACCTGTTGCCGCTGGTTATCATCACTCTAATAATCGGCTATATGGACAGAGAGAATTACTTTGTGAGCTCAGAAGTAAAGTTTGCCACAGCATTGATCTCCATTATCCCATTGTCCTACTACATCGGGATGGGAATAGCAAGGTAACAATAAAATTCCCACTCATTTTATTATTATTAATATTTGTTAAATGGATTTATTCACCTAAATATAATATTTCCTCATTGCCTTTTCGTAATATTTCTTCTATATTATTAATAAAAATTATTTTTTTCAAAAAGAAATCTCTGTAAAAACCTCTGTTTTCTCTGTAGTATTTCCGCACAGAGTAACTTTGCTGTGGGAGCGGTAGTAAACGCCACGTTCGGCTCCATTACAGAGATGGCCTTCTACATCACAGCTTTACTCCAGGGTCAGCGTGCGGGATCCCAGTGTTA[T/A]GCAGAACTTGTCAAATCTGCTCTCACAGGCACCCTGCTGGGCTGTATCCTCTTCATACCGGTGTGCTGCTTCAGCCATTCTGCTTCAGACATCTAGTTATGCATTCAGAAGCCTCTCATAACTGTGATTTGTGTGTGTTTAAGGGGCTCTGTATGATCATTGGCGGCTTTAAACACAGCGAGCAGCGGTTCAACAGCAGGTCAGCAGGTGTCAGTTCAGCACTGCTCTTCATATCAGTAGGAGGTAAAAAAAATTCTCTGGAATTTCATTATTTACTCATTGTACACTTGTTTTACATCTGTATGCGATTTGTACGTTTGCTTTTAACCAGAAGAAAGTTTGATTGAAAGTTTGATTCAAAAGCAAATTGCAATGATTCAATCATTTCCTAATTGTTGTCTCGTTCATGAAGCCATTTGACATCTTTTAATAGATGCAACTCTTTGTGACCTTTCATCTCTCTCTGACTGCAGGTGTTTTCGCCCCCACGCTCTTTTCGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa9985
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067046 Essential Splice Site 678 764 18 20
Genomic Location (Zv9):
Chromosome 4 (position 14055026)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 14990879
GRCz11 4 14989634
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATATATGATCTGTATGTTCCTCTGATTGCATTTTACTGTCAATCRTTCA[G/A]TCTGGAGGTGGGGAGTTGTTTAGCAGTTCAGGTGTGCATGCTGCAGATCC
Long Flanking Sequence:
ATATATTGTTTTTTATTATATATATTTCCTTTTTTTTTTAATAAAATGAAATTATTTTGATTTGATTCTAATTTATATTTATACTTGAAATGTTTTCTTTGCTCATTTCACATGGGATTTATTTATTATTTCACATTTTTCATTTTAGTTTTTATATTAAATTAAAATAATTTAAGTTTTATTATAAAAATTGAATAAATTTATTTTTAAAAAGTACTTTAAAAAAAATAATAACTTGTAGTATTTTACTTAATTCTTTAGTCTCCTTTTATTTCACATATGGATATTTATGACATGATAGTATGTGTATTCCTTTGCAGTATTTTATTGGCGTTACTATAATAGCCATGGTTCCTGAGCTTCCTGAGATAGTCAATGGCGTCCAGTTTGCGCTTCAAAACAACATCAGTCTCAGGTTGCAACAATTAAAATACAAACATCTCTGTTTTCTATATATGATCTGTATGTTCCTCTGATTGCATTTTACTGTCAATCATTCA[G/A]TCTGGAGGTGGGGAGTTGTTTAGCAGTTCAGGTGTGCATGCTGCAGATCCCTCTACTCATCTTGTTCAATGCTTTTTACGTAAGTGCTACTCTAAATAACTTGAGCATGGTTTCTTTTACTCTGTTCTGACGTATGACAAGTTCTTCCTCTTTCATCCAAGGATGTTGGATTCGTTCTCATATTCAGCGATTTGCACCTCTGGGCAAGCATCTTCAGCGTTATCCTGGTAAACTACATATTTATGGATGGAAAGTCAGACTATTTCCAAGGTAAGCATTAGTTGAACCTATGTTACAATAGCTTTTATATAAGGAATATCTTTGTGAAATGTGCTTGATGATCGCCATTTTATTTACGCTTTATAGAAAGAGTTCGGCTATAAATAAGTGGCATGTGTTCAACTAGGGAAAAAAAAAAGTTATGCTGGTTTACAATTGACAGGATTTGTTTTGGGTAAACAAAAATGGAACATGAAGAATTTTATTTAATTTTGTTGCAT
Associated Phenotype:
Not determined