Busch Lab

ZMP

noc4l

Ensembl ID:
ENSDARG00000045565
ZFIN ID:
ZDB-GENE-050522-98
Description:
Nucleolar complex protein 4 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q4VBT2]
Human Orthologue:
NOC4L
Human Description:
nucleolar complex associated 4 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:28461]
Mouse Orthologue:
Noc4l
Mouse Description:
nucleolar complex associated 4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2140843]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10349 Nonsense Available for shipment Available now
sa9300 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa10349
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067001 Nonsense 66 525 2 15
ENSDART00000067001 Nonsense 66 525 2 15
Genomic Location (Zv9):
Chromosome 21 (position 13027823)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14728997
GRCz11 21 14825726
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGAAAAAGAAATCATTTTYGCCACYAACGCGTGCAGTAAGATCTTCTG[T/A]GAGCTGATAGAGMGAGGAGATCTGTTTGTTGGTGAACTGCCCAAAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9300
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067001 Nonsense 66 525 2 15
ENSDART00000067001 Nonsense 66 525 2 15
Genomic Location (Zv9):
Chromosome 21 (position 13027823)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14728997
GRCz11 21 14825726
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGGAAAAAGAAATCATTTTYGCCACYAACGCGTGCAGTAAGATCTTCTG[T/A]GAGCTGATAGAGMGAGGAGATCTGTTTGTTGGTGAACTGCCCAAAGAAGA
Associated Phenotype:
Not determined