Busch Lab

ZMP

dram1

Ensembl ID:
ENSDARG00000045561
ZFIN ID:
ZDB-GENE-041010-147
Description:
DNA damage-regulated autophagy modulator protein 1 [Source:RefSeq peptide;Acc:NP_001006049]
Human Orthologue:
DRAM1
Human Description:
DNA-damage regulated autophagy modulator 1 [Source:HGNC Symbol;Acc:25645]
Mouse Orthologue:
Dram1
Mouse Description:
DNA-damage regulated autophagy modulator 1 Gene [Source:MGI Symbol;Acc:MGI:1918962]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20252 Essential Splice Site Available for shipment Available now
sa40268 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa20252
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066997 Essential Splice Site 66 240 2 7
Genomic Location (Zv9):
Chromosome 4 (position 16735890)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17678730
GRCz11 4 17667706
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGAGAGCTGTGTGTTTGGATTCATGTCGACAATTACGGCATTCGCAG[G/A]TATGACTAACAATCAGCTCTTTGATTTCAGTTTGATTTGATATCCCGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40268
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066997 Essential Splice Site 115 240 4 7
Genomic Location (Zv9):
Chromosome 4 (position 16733231)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17676071
GRCz11 4 17665047
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCAATAGTGATTTAATGGCACTCATGTATTGTATGCATGTTTTGTTACA[G/T]GAGACGACAGTGATGGAAGTCCATGATATCGGTGCTCTTTTATTCTTCAT
Associated Phenotype:
Not determined