Busch Lab

ZMP

OTUD7A

Ensembl ID:
ENSDARG00000045556
Description:
OTU domain containing 7A [Source:HGNC Symbol;Acc:20718]
Human Orthologue:
OTUD7A
Human Description:
OTU domain containing 7A [Source:HGNC Symbol;Acc:20718]
Mouse Orthologue:
Otud7a
Mouse Description:
OTU domain containing 7A Gene [Source:MGI Symbol;Acc:MGI:2158505]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa24721 Nonsense Available for shipment Available now
sa38128 Nonsense Mutation detected in F1 DNA Not yet available
sa44345 Nonsense Mutation detected in F1 DNA Not yet available
sa18655 Nonsense Available for shipment Available now
sa24722 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30299
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012677 Essential Splice Site 7 933 1 15
Genomic Location (Zv9):
Chromosome 25 (position 35591107)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 33967039
GRCz11 25 34407661
KASP Assay ID:
554-5526.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGTGATTGTATTACTCATCAGAACTGATCTTCTGTACCGACTGCTCTCAT[C/G]TGATGTGTGTGTTTGTGTGTTGTTTTGTCCAGATGCGAGTGTGAAGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24721
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012677 Nonsense 46 933 2 15
Genomic Location (Zv9):
Chromosome 25 (position 35591255)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 33967187
GRCz11 25 34407809
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTCCTGTCAGACTTTGTTCGGTCCACAGGGGCAGAACCGGGTCTGGCA[C/T]GAGACCTGCTGGAAGGTAAGAGAGACCCCATCGGGACTTTGTTTCTGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38128
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012677 Nonsense 271 933 9 15
Genomic Location (Zv9):
Chromosome 25 (position 35610030)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 33985962
GRCz11 25 34426584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTGGTGTACACGGAGGAGGAATGGGAGAGAGAGTGGAACGAGCTGCTA[A/T]AACTGGCCTCCAGCGAGCCCCGCACACACTTCAGCAAGAACGGCAACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44345
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012677 Nonsense 408 933 12 15
Genomic Location (Zv9):
Chromosome 25 (position 35637904)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34013836
GRCz11 25 34454458
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGCACAAGCTGCTGGCGTTGCATTTTGCGGTGGACCCTGGGAGGGACT[G/A]GGAGTGGGGGAGGGATGACAATGACAATGCTAAGCTGGCAAAGTAAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18655
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012677 Nonsense 569 933 14 15
Genomic Location (Zv9):
Chromosome 25 (position 35640732)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34016664
GRCz11 25 34457286
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACGGTGGAGAACGSAGAGCAGAAATCCAAGAAAAAGGACTCGAAAACA[C/T]GRAAAGGAAGCAAAGAGGAGTCAGGCCAGTCGGCCAGYACGTCCTCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24722
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012677 Nonsense 573 933 14 15
Genomic Location (Zv9):
Chromosome 25 (position 35640744)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34016676
GRCz11 25 34457298
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGGAGAGCAGAAATCCAAGAAAAAGGACTCGAAAACACGAAAAGGAAGC[A/T]AAGAGGAGTCAGGCCAGTCGGCCAGCACGTCCTCCTCAGAGAAGGCAACC
Associated Phenotype:
Not determined