Busch Lab

ZMP

lamb1b

Ensembl ID:
ENSDARG00000045524
ZFIN ID:
ZDB-GENE-041210-197
Description:
Novel protein similar to vertebrate laminin, beta family protein [Source:UniProtKB/TrEMBL;Acc:Q5RH37
Human Orthologue:
LAMB1
Human Description:
laminin, beta 1 [Source:HGNC Symbol;Acc:6486]
Mouse Orthologue:
Lamb1
Mouse Description:
laminin B1 Gene [Source:MGI Symbol;Acc:MGI:96743]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa40306 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available
sa6949 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available
sa7552 Essential Splice Site, Missense Mutation detected in F1 DNA Not yet available
sa2150 Nonsense F2 line generated Not yet available
sa31399 Essential Splice Site Available for shipment Available now
sa33474 Nonsense Mutation detected in F1 DNA Not yet available
sa15082 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40306
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066945 Essential Splice Site 12 1767 2 33
ENSDART00000141133 Missense 2 1714 1 32
Genomic Location (Zv9):
Chromosome 4 (position 24793171)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25716840
GRCz11 4 25706038
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCATTTAATTTGAAACACACTCTGATCAAATCAAATGCGTTTCCCACA[G/A]CTATTGCTCTGCACACTTTGGCACAACTGCCCGATCACAATGACATGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6949
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066945 Missense 449 1767 10 33
ENSDART00000141133 Essential Splice Site 436 1714 9 32
ENSDART00000066945 Missense 449 1767 10 33
ENSDART00000141133 Essential Splice Site 436 1714 9 32
Genomic Location (Zv9):
Chromosome 4 (position 24808777)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25732446
GRCz11 4 25721644
KASP Assay ID:
554-4301.1 (used for ordering genotyping assays)
KASP Sequence:
TGACCACTGTAAAAAGGGACACTATGGCCTCAGCGATGACCCGTTAGGCT[G/T]TCGGTGTATGTAAACACAAATTTACAMAAAGCAGTTGCTTTTTTAAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7552
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066945 Missense 449 1767 10 33
ENSDART00000141133 Essential Splice Site 436 1714 9 32
ENSDART00000066945 Missense 449 1767 10 33
ENSDART00000141133 Essential Splice Site 436 1714 9 32
Genomic Location (Zv9):
Chromosome 4 (position 24808777)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25732446
GRCz11 4 25721644
KASP Assay ID:
554-4301.1 (used for ordering genotyping assays)
KASP Sequence:
TGACCACTGTAAAAAGGGACACTATGGCCTCAGCGATGACCCGTTAGGCT[G/T]TCGGTGTATGTAAACACAAATTTACAMAAAGCAGTTGCTTTTTTAAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2150
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066945 Nonsense 629 1767 15 33
ENSDART00000141133 Nonsense 615 1714 14 32
Genomic Location (Zv9):
Chromosome 4 (position 24813232)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25736901
GRCz11 4 25726099
KASP Assay ID:
554-2568.1 (used for ordering genotyping assays)
KASP Sequence:
TATAGTTGCCAGATGAATGGGAGCAGGTTATAGTAAAGTTGGAGCGGCCC[A/T]GAGACATTGATCAGTCAACACACTGCACTACTACATACGATGATGAACAG
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa31399
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066945 Essential Splice Site 654 1767 15 33
ENSDART00000141133 Essential Splice Site 640 1714 14 32
Genomic Location (Zv9):
Chromosome 4 (position 24813310)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25736979
GRCz11 4 25726177
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACTACATACGATGATGAACAGATGGTCTCACTGCACCCTGGATCAAGG[T/C]ACGTGGACGTTACATGTACACAAAAACATTCCACTAAAAACAGATGTAGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26306
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066945 Nonsense 899 1767 20 33
ENSDART00000141133 Nonsense 883 1714 19 32
Genomic Location (Zv9):
Chromosome 4 (position 24819567)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25743236
GRCz11 4 25732434
KASP Assay ID:
2259-4992.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCAGGTGTGAAAGTGGTTATCACCGTAGCACATTGTTGGGCTCCAGAGAT[C/T]AATGCAGGCCTTGTATGTGTCCTAATGGACCCGGAAGTGGTATGCAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33474
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066945 Nonsense 1233 1767 24 33
ENSDART00000141133 Nonsense 1217 1714 23 32
Genomic Location (Zv9):
Chromosome 4 (position 24827106)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25750775
GRCz11 4 25739973
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGAGAGATACTGGAGGATGACAAGGTTCAGCAAACTTTCGCACACACG[C/T]AGAGGATGATGAAGAAAGCTAGGTATGTAGAAGAAATGCATTTATTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15082
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066945 Nonsense 1334 1767 26 33
ENSDART00000141133 Nonsense 1318 1714 25 32
Genomic Location (Zv9):
Chromosome 4 (position 24830134)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25753803
GRCz11 4 25743001
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATTTCCGTGYCARTCAAGCCATCTCTGAACCAGTCAGACAGTCTGCCT[T/A]GCTWCGAAAAGATRCAGAGGCCAARCTAGAAAGAACTGAGAATGAATTTA
Associated Phenotype:
Not determined