Busch Lab

ZMP

si:dkeyp-89c11.3

Ensembl ID:
ENSDARG00000045522
ZFIN ID:
ZDB-GENE-041210-203
Description:
hypothetical protein LOC557032 [Source:RefSeq peptide;Acc:NP_001020658]
Human Orthologues:
ACOT1, ACOT2, ACOT4, ACOT6, BAAT
Human Descriptions:
acyl-CoA thioesterase 1 [Source:HGNC Symbol;Acc:33128]
acyl-CoA thioesterase 2 [Source:HGNC Symbol;Acc:18431]
acyl-CoA thioesterase 4 [Source:HGNC Symbol;Acc:19748]
acyl-CoA thioesterase 6 [Source:HGNC Symbol;Acc:33159]
bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase) [Source:HGNC Symbol;Acc:9
Mouse Orthologues:
Acnat1, Acnat2, Acot1, Acot2, Acot3, Acot4, Acot5, Acot6, Baat
Mouse Descriptions:
acyl-CoA thioesterase 1 Gene [Source:MGI Symbol;Acc:MGI:1349396]
acyl-CoA thioesterase 2 Gene [Source:MGI Symbol;Acc:MGI:2159605]
acyl-CoA thioesterase 3 Gene [Source:MGI Symbol;Acc:MGI:2159619]
acyl-CoA thioesterase 4 Gene [Source:MGI Symbol;Acc:MGI:2159621]
acyl-CoA thioesterase 5 Gene [Source:MGI Symbol;Acc:MGI:2384969]
acyl-CoA thioesterase 6 Gene [Source:MGI Symbol;Acc:MGI:1921287]
acyl-coenzyme A amino acid N-acyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2140197]
acyl-coenzyme A amino acid N-acyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2444345]
bile acid-Coenzyme A: amino acid N-acyltransferase Gene [Source:MGI Symbol;Acc:MGI:106642]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa40304 Nonsense Mutation detected in F1 DNA Not yet available
sa20290 Nonsense Available for shipment Available now
sa9080 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa38443 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40304
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041965 Nonsense 4 450 2 12
ENSDART00000066942 None None 430 None 11
ENSDART00000133425 Nonsense 4 450 1 11
Genomic Location (Zv9):
Chromosome 4 (position 24717731)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25641400
GRCz11 4 25630598
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCTAGTTTGATTTACTGTAATCAATTTATTATCACAAATGAAACGCTG[G/A]TCTACTCTTATCGGACGTGTCATCATGCTAGCACCAGTTAGGTAATGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20290
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041965 Nonsense 104 450 4 12
ENSDART00000066942 Nonsense 103 430 3 11
ENSDART00000133425 Nonsense 104 450 3 11
Genomic Location (Zv9):
Chromosome 4 (position 24720072)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25643741
GRCz11 4 25632939
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAGATGAAAGTTTGGGAGGCACGTATGAAGGGACAGAGCAGATGGGTT[T/A]GCTGTGGAGCTTGAGGCCTGTACCAGGAAGTCGATCTGCACTCAGGTAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5264
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041965 Nonsense 106 450 4 12
ENSDART00000066942 Nonsense 105 430 3 11
ENSDART00000133425 Nonsense 106 450 3 11
Genomic Location (Zv9):
Chromosome 4 (position 24720078)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25643747
GRCz11 4 25632945
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGAAAGTTTGGGAGGCACGTATGAAGGGACAGAGCAGATGGGTTTGCTGT[G/A]GAGCTTGAGGCCTGTACCAGGAAGTCGATCTGCACTCAGGTAAGTTAYCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9080
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041965 Splice Site, Nonsense 120 450 5 12
ENSDART00000066942 Splice Site, Nonsense 119 430 4 11
ENSDART00000133425 Splice Site, Nonsense 120 450 4 11
Genomic Location (Zv9):
Chromosome 4 (position 24720241)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25643910
GRCz11 4 25633108
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ASCGAGGTCATTAKTTTTATTTATTCCTAYACNTTTTTTATTATTCAAGRT[T/A]RCGCAAGATGAATGTACTCACGCCRATGGTAGTTAASATATCAGTCTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38443
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041965 Essential Splice Site 336 450 9 12
ENSDART00000066942 Essential Splice Site 335 430 8 11
ENSDART00000133425 Essential Splice Site 336 450 8 11
Genomic Location (Zv9):
Chromosome 4 (position 24727378)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25651047
GRCz11 4 25640245
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGAGAAATTATCTTGCCGATTCCCTCAGACCCGGCTCTCAAAGCAGACG[T/A]ATGTATGACTTTAGTATGTTTTTCTTTTCAGTGTGTTTTCATTTTTTTAA
Associated Phenotype:
Not determined