Busch Lab

ZMP

itih5

Ensembl ID:
ENSDARG00000045517
ZFIN ID:
ZDB-GENE-041210-193
Description:
Novel protein similar to vertebrate inter-alpha (Globulin) inhibitor H5 (ITIH5) [Source:UniProtKB/Tr
Human Orthologue:
ITIH5
Human Description:
inter-alpha (globulin) inhibitor H5 [Source:HGNC Symbol;Acc:21449]
Mouse Orthologue:
Itih5
Mouse Description:
inter-alpha (globulin) inhibitor H5 Gene [Source:MGI Symbol;Acc:MGI:1925751]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8581 Nonsense Mutation detected in F1 DNA Not yet available
sa8448 Nonsense Mutation detected in F1 DNA Not yet available
sa20287 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa8581
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066934 Nonsense 6 949 1 14
ENSDART00000126356 None None 200 None 7
ENSDART00000130289 None None 314 None 9
ENSDART00000138121 None None 906 None 11
ENSDART00000066934 Nonsense 6 949 1 14
ENSDART00000126356 None None 200 None 7
ENSDART00000130289 None None 314 None 9
ENSDART00000138121 None None 906 None 11
Genomic Location (Zv9):
Chromosome 4 (position 24307567)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25231236
GRCz11 4 25220434
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATARATAATTATGAGATTTGAGTATTTCTTAAATTATGTATTTGGATT[C/A]ATTTTKCAGTGCTACAAGCWGNNNTTTTTTTCTATTTGCTAAATATCCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8448
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066934 Nonsense 6 949 1 14
ENSDART00000126356 None None 200 None 7
ENSDART00000130289 None None 314 None 9
ENSDART00000138121 None None 906 None 11
ENSDART00000066934 Nonsense 6 949 1 14
ENSDART00000126356 None None 200 None 7
ENSDART00000130289 None None 314 None 9
ENSDART00000138121 None None 906 None 11
Genomic Location (Zv9):
Chromosome 4 (position 24307567)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25231236
GRCz11 4 25220434
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAATARATAATTATGAGATTTGAGTATTTCTTAAATTATGTATTTGGATT[C/A]ATTTTKCAGTGCTACAAGCWGNNNTTTTTTTCTATTTGCTAAATATCCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20287
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000066934 Nonsense 763 949 12 14
ENSDART00000126356 None None 200 None 7
ENSDART00000130289 None None 314 None 9
ENSDART00000138121 Nonsense 723 906 10 11
Genomic Location (Zv9):
Chromosome 4 (position 24329881)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25253550
GRCz11 4 25242748
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACTATTGTAGCAGATAAACCAAAACGCTCATACATTGAGGTGACAACA[C/T]AAAAAGTGATCTTGGACGGACGAGACCGGATGATTCTCCCCACCAGCTCC
Associated Phenotype:
Not determined